One germline mutation of PTCHgene in a Chinese family with non-syndromic keratocystic odontogenic tumours

Abstract

Keratocystic odontogenic tumours (KOCTs) are common benign cystic tumours that arise sporadically or associated with nevoid basal cell carcinoma syndrome (NBCCS). PTCH mutation can be found in sporadically or NBCCS associated KOCTs. Few PTCH mutations in families with non-syndromic KOCTs have been reported. Through PCR and gene sequence analysis, the authors discovered one missense mutation c.3277G>C in exon 19 of PTCH gene in a Chinese family with non-syndromic KOCTs. This mutation causes one highly conserved glycine residue transit to arginine on the 10th transmembrane region of PTCH protein. This work revealed that the missense mutation of PTCH is the causative and dominant gene of KOCTs in this family.

Keratocystic odontogenic tumours (KOCTs) are common benign cystic tumours that have the potential to behave aggressively and destroy portions of the jaws. In 2005, WHO renamed odontokeratocysts to KOCTs . The majority of cysts arises sporadically and in single form on the jaws of middle-aged people . When associated with nevoid basal cell carcinoma syndrome (NBCCS), these lesions appear earlier, often during the first or second decade of life, and may be (often) multiple and easily recrudescent . NBCCS is a rare autosomal dominant disease characterized by multiple basal cell carcinomas, KOCTs of the jaws, palmar and/or plantar pits, calcifications of the falx cerebri, skeletal anomalies, and a variety of other benign or malignant tumours. It is now thought that PTCH , the human homolog of the Drosophila patched gene, is responsible for this syndrome. PTCH (GenBank accession number: NC_000009.10 ) is a tumour suppressor gene located at chromosome 9q22.3, the genomic sequence is about 64 kb and at least 24 exons (including 23 coding exons), and it encodes a 1447 amino acid transmembrane protein that is thought to be a receptor for Hedgehog (Hh) .

Since the discovery in 1996 that PTCH is a gene responsible for NBCCS , about 280 mutations, to the authors’ knowledge, have been reported worldwide . Mutations of PTCH have not only been found in NBCCS, but have also been found in other sporadic malignancies, including sporadic keratocystic odontogenic tumours .

In their clinical work, the authors have found that patients in some families only have multiple KOCTs without the other symptoms of NBCCS. These types of disease were nominated as familial KOCTs. According to the literature review, the mutations of PTCH in these families have seldom been investigated; only one germline mutation of PTCH in one Chinese family has been reported . In this article, the authors report a germline mutation of PTCH gene in another Chinese family with non-syndromic KOCTs.

Materials and methods

With the informed consent of all nine family members, peripheral blood samples were collected. Genomic DNA was isolated from blood samples with QIAmp Blood Mid Kit (Qiagen, German). Twenty-one pairs of primers were designed and used for the amplification of the 23 exons of the PTCH gene ( Table 1 ).

Table 1
Primers used for amplification of 23 exons of PTCH gene.
Exons Primers Product size
Exon 1 F:AGCGGCTGGTCTGTCAAC
R: TGGACGGCTTTCCAGTG
674 bp
Eoxn 2 F: TGGCGAATATCTCTATCAA
R: TGAATATTATCTGTGTCGAG
600 bp
Exon 3 F: TAATGCACTTGCTTTGTTAC
R: CATTAATGGGCTTAGTGAGT
600 bp
Exons 4 and 5 F: ACTGAAATGGAACAAACAAT
R: GAAAAGCAGATTAATGGTGT
644 bp
Exons 6 and 7 F: CGAGGATAACGGTTTAAGTA
R: AGCCGTGTTACTTTACGAT
804 bp
Eoxn 8 F: CTAATGTTTTCCAGACACCT
R: TGGGGTATATCTGTAAAAGG
674 bp
Exon 9 F: GACCACTTTTAAACCACTGT
R: CCTGGAGTAAATACAGCACT
562 bp
Exon 10 F: CCTGGTCAATGACATACAT
R: CCCTTGATGTAAAGTTTTGT
548 bp
Exon 11 F: GAGTCTTCCAGCTTATTTCA
R: GAGAATGTGCACTTCAGG
584 bp
Exon 12 F: ACTCTATAAGGCAACAGACG
R: GAGATGTCTGTCACTTAGCC
689 bp
Exon 13 F: GCAGAGATATGAAACATTCC
R: TCCTATCAAATAGGCTCTTG
594 bp
Exon 14 F: GAACTCCAAAGGTTCTGTTA
R: GCTGTGTAAAATGGGTATTC
569 bp
Exon 15 F: GCTGCTGCAGAAACAGTTCA
R: TGGCAACACAAGACTGTCTCA
698 bp
Exon 16 F: ATTCTGACAATTGTTCTGGT
R: AAGATCCAGTGCTTTCAGT
570 bp
Exon 17 F: CCAGAGTTTTAAACGAGAAG
R: GCATTCAGATTTAATTGGTT
596 bp
Exon 18 F: CTTCAAGCTACAGGAGAGAG
R: CTTTCATGCAAAGTTCTTCT
583 bp
Exon 19 F: GAAAGGAATCCAGAAATCTT
R: TACTTTGCCTTCTACAGCTT
525 bp
Exon 20 F: TATATTTTGAGTGGAGATGA
R: GTTCAAGATTTACGTCAACA
538 bp
Exon 21 F: TTGATTTAGAGGAACCAAAC
R: TCCCTTCATGAACTAACACT
538 bp
Exon 22 F: GGAAGATGGCATTTGTATAG
R: GTAGAGAAGGGGAGGTTAAT
597 bp
Exon 23 F: CTCTGGGGATAAAAGGTC
R: GACTGAGTCTTTGGTGAAAC
788 bp

Polymerase chains reactions (PCRs) except exon 1 were performed in 15 μl volumes containing 20 ng of template DNA, 300 mM dNTP, 0.8 mM MgCl 2 , 1.5 mM Q-solution (Qiagen, German), 0.2 μM of each primer, 0.6 unit Taq polymerase (Takara, Japan) in 1.5 μl 10× PCR buffer (Qiagen, German). The cycling conditions (standard Touchdown System) are: 3 min at 94 °C, followed by 12 cycles of 40 s at 94 °C, 40 s at 63 °C (decreased 0.5 °C after each cycle), 1 min at 72 °C, followed by 30 cycles of 40 s at 94 °C, 40 s at 57 °C, 1 min at 72 °C.

PCR of exon 1 was performed in 15 μl volumes containing 20 ng of template DNA, 300 mM dNTP, 0.2 μM of each primer, 1.0 unit kod-plus polymerase in 1.5 μl 10× PCR buffer (special for kod-plus polymerase). The cycling conditions are: 2 min at 94 °C, followed by 14 cycles of 15 s at 94 °C, 30 s at 64 °C (decreased 0.5 °C after each cycle), 1 min at 68 °C, followed by 30 cycles of 15 s at 94 °C, 30 s at 57 °C, 1 min at 68 °C.

Sequencing reaction products were loaded onto an ABI 3730 Automatic Sequencer (Applied Biosystems, USA). This part of the technology was supported by the Chinese National Human Genome Center at Shanghai, China.

Results

The pedigree structure of this family is shown in Fig. 1 . The proband was a 29-year-old patient (III:1), a panoramic radiograph revealed a multiple cyst radiolucent lesion in the jaw ( Fig. 2 ). Odontogenic keratocysts (OKCs) and dentigerous cysts (DCs) were pathologically diagnosed in five affected members. No other symptoms or indications associated with NBCCS were found in this family, such as basal cell carcinomas, palmer or plantar pits, calcification of the falx cerebri, bifid or fused ribs, and tumour symptoms. All the patients in this family had had OKC extraction surgery at least once ( Table 2 , Fig. 3 ).

Feb 5, 2018 | Posted by in Oral and Maxillofacial Surgery | Comments Off on One germline mutation of PTCHgene in a Chinese family with non-syndromic keratocystic odontogenic tumours
Premium Wordpress Themes by UFO Themes