Introduction
Mandibular retrognathism may be the result of a developmental abnormality or the unfavorable positional relationship of developing jaws. Several lines of evidence suggest that muscles are known to have extensive mutual effects on bones. Studies with immunohistochemical staining and gene expression have shown unique combinations of myosin heavy chain isoforms in the masseter muscles. In this study, we aimed to evaluate MYO1H gene polymorphisms and haplotypes as risk factors for mandibular retrognathism.
Methods
Twenty-five subjects with mandibular retrognathism and 25 control subjects of both sexes having an orthognathic maxilla (SNA, 82° ± 2°) between the ages of 12 and 30 years of age were selected for this study. Based on the cephalometric values, subjects with SNB angles smaller than 78° were considered to have mandibular retrognathism. Orthognathic subjects (SNB, 80°) without jaw deformations were used as the comparison group. Three polymorphisms of MYO1H gene (rs10850110, rs11611277, and rs3825393) were genotyped using polymerase chain reaction and restriction fragment length polymorphism. Associations were tested with the Pearson chi-square test and haplotype analyses.
Results
The single nucleotide polymorphism rs3825393 showed a statistically significant association with mandibular retrognathism. The cephalometric variables SNB and ANB angles showed significant differences among the various genotypes of rs3825393. Linkage disequilibrium was not strong and significant between the single nucleotide polymorphisms; hence, the haplotypes of the MYO1H gene are not associated with mandibular retrognathism.
Conclusions
These results suggest that the rs3825393 polymorphism of the MYO1H gene is associated with an increased risk for mandibular retrognathism. The relatively small sample size used in the study resulted in modest statistical power. A parallel investigation on another population with larger samples to increase the power could further clarify the role of the MYO1H gene in causing mandibular retrognathism.
Highlights
- •
We evaluated MYO1H gene polymorphisms as a risk factor for mandibular retrognathism.
- •
Polymorphisms of MYO1H gene (rs10850110, rs11611277, and rs3825393) were analyzed.
- •
rs3825393 showed a statistically significant association with mandibular retrognathism.
- •
SNB and ANB showed significant differences among different genotypes of rs3825393.
- •
rs3825393 polymorphism of the MYO1H is associated with an increased risk for mandibular retrognathism.
An understanding of the normal growth and development of the face enables the orthodontist to assess the effects of orthodontic and orthopedic forces that can modify this growth. Recent theoretical and experimental studies have fundamentally altered our understanding of both the functional anatomy and the growth process of the jaw. Prognathism and retrognathism of either jaw may be the result of a developmental abnormality or the unfavorable positional relationship of developing jaws. Several lines of evidence suggest that muscles have extensive mutual effects on bones. These effects translate into changes in the mechanical forces on areas of bone where muscles attach, and this leads to modification of skeletal areas such as the coronoid process and the gonial angle area of the mandible. Genetic alterations that affect muscles also would affect these skeletal areas.
The composition ratio of muscle fibers is greatly influenced by genetic factors and rarely by environmental factors. The myosin heavy chain isoforms are required for the structural and functional integrity of skeletal muscle. These proteins comprise a family of molecular motor proteins, eight of which are expressed in mammalian cardiac and skeletal muscles. Each of these 8 is characterized by its time- and site-specific expression pattern. Two principal developmental isoforms are responsible for the protein synthesis expressed in embryonic and neonatal skeletal muscle, and 4 isoforms are expressed in adult fast-twitch skeletal muscles. The genes coding for myosin heavy chain isoform proteins that are primarily expressed in skeletal muscles are located in human chromosomes 11 and 17, respectively. Myosins constitute a superfamily of motor proteins that bind to actin and use the energy of adenosine triphosphate hydrolysis to generate force and movement along actin filaments. Phylogenetic analysis currently places myosins into 17 classes based on class-specific features of their conserved motor domain.
The myosin class I was the first unconventional myosin to be discovered, comprising 8 isozymes, Myo1a to Myo1h, which have been implicated in various motile processes including organelle translocation, ion-channel gating, and cytoskeleton reorganization. Immunohistochemical staining and gene expression studies revealed the presence of unique combinations of myosin heavy chain isoforms in the masseter muscle. Although single orofacial and limb muscle fibers contain 1 or 2 myosin heavy chain types, single masseter fibers coexpress up to 4 different myosin heavy chain isoforms. Recent studies have assessed the polymorphism of the myosin 1H ( MYO1H ) gene in mandibular prognathism. Although mandibular retrognathism involves abnormalities of the masticatory and cervical muscle complex, no study has been conducted to assess the role of myosin in the development of a retrognathic mandible. Hence, in this study, we aimed to assess the role of the MYO1H gene polymorphisms in mandibular retrognathism.
Material and methods
Subjects of both sexes between 12 and 30 years of age were included in this study. Twenty-five patients having a retrognathic mandible (SNB, <78°) were selected as the subjects, and another 25 patients with an orthognathic mandible (SNB, 80°) were selected as the controls. Both subjects and controls had an orthognathic maxilla (SNA, 82° ± 2°). Those with a retrognathic or prognathic maxilla (SNA, <80° and >82° ± 2°) were excluded from the study. Sri Ramachandra University institutional ethics committee’s approval was obtained before the study (reference number: CSP/12/JUL/24/108, dated July 15, 2012). Informed written consent was received from all participating persons. From each study subject, lateral cephalograms were obtained. Tracings of the lateral cephalograms were done manually on acetate matte tracing paper. Different angular, linear, and planar values were measured on the tracings of both subjects and controls.
For the genotyping, 3 mL of blood was obtained from all participants, and DNA was isolated using the modified salting out method. Briefly, red blood cells were washed out with Tris-EDTA buffer, and the pellet was resuspended in 3 to 5 mL of the DNA extraction buffer and incubated at 37°C overnight with proteinase K. Finally, 6 mL of ethanol was added to precipitate the DNA. Three single nucleotide polymorphisms of the MYO1H gene rs10850110 (promoter polymorphism), rs11611277 (Exon 1; Ser-37-Arg), and rs3825393 (Exon 30; Leu-1001-Pro) were genotyped using polymerase chain reaction and restriction fragment length polymorphism (PCR-RFLP). The primers and restriction enzymes used in genotyping are documented in Table I . The PCR amplified products were examined by agarose gel electrophoresis before and after restriction digestion. The size of the PCR amplicon corresponding to the different genotypes of each single nucleotide polymorphism were determined by comparing 100 base pairs DNA markers.
| SNP | PCR primers (5′-3′) | Fragment sizes after PCR (bp) | Enzyme | Fragment sizes after digestion (bp) |
|---|---|---|---|---|
| rs10850110 | ACTTTGCCTTCCCCTGGTTA | 291 | Sau96I | G = 263 bp+28 bp |
| CTGAGGCAGGAGGATTGTCT | A = 291 bp | |||
| rs11611277 | TCCCAGGGTTTAGCATCTTG | 386 | Hpy188I | A = 241 bp + 146 bp |
| GAGTGGCGCCTCAGTATCTC | C = 38 6bp | |||
| rs3825393 | GGCTTACTTCCCTCCCAGAG | 302 | Sau96I | G = 226 bp + 76 bp |
| CTGTGGCAACAGCATTCTTC | A = 302 bp |
Statistical analysis
Allele frequencies were determined by direct counting of alleles at each locus. The genotype distribution was evaluated for the Hardy-Weinberg equilibrium. To identify the association of candidate gene polymorphisms and the retrognathic mandible, the chi-square test was performed. Odds ratios (ORs) and 95% confidence intervals (95% CIs) were calculated using wild-type genotypes or alleles as reference groups. Linkage disequilibrium (LD) values of D′ and r 2 were estimated using Haploview software version 3.12 (Broad Institute of MIT and Harvard, Mass).
Results
The data of cephalometric analyses of all subjects are documented in Table I . A cephalometric comparison of patients with mandibular retrognathism and the controls showed that except for SNB and ANB, the remaining measurements were statistically similar between the groups ( Table II ). Various values denoting the growth pattern did not show significant differences between the control and retrognathic groups ( Table II ). Genotyping using PCR-RFLP on the DNA samples of all retrognathic subjects and controls showed that all 3 single nucleotide polymorphisms are polymorphic. None of the polymorphic sites deviated from Hardy-Weinberg equilibrium in the controls ( Table III ). Results of the association between retrognathism and MYO1H gene polymorphisms are presented in Table III . The rs10850110 and rs11611277 single nucleotide polymorphism genotypes and alleles were not significantly different between the retrognathic subjects and the controls. The rs3825393 genotypes showed significant differences between the subjects and the controls ( P = 0.035). However, this polymorphism has shown a significant association with retrognathism in a dominant model ( P = 0.024; OR, 3.78; 95% CI, 1.01-14.63) but not in an allelic model ( P = 0.130; OR, 1.94; 95%CI, 0.82-4.61).
| Cephalometric measure | Control group | Subject group | P value |
|---|---|---|---|
| SNA (°) | 82.16 ± 1.52 | 81.44 ± 1.42 | 0.089 |
| SNB (°) | 79.32 ± 1.65 | 74.40 ± 1.87 | <0.001 |
| ANB (°) | 2.84 ± 1.46 | 7.04 ± 1.77 | <0.001 |
| Go Gn to SN (°) | 32.16 ± 5.85 | 32.60 ± 5.07 | 0.777 |
| Frankfort horizontal to Go Me (°) | 26.84 ± 5.89 | 27.44 ± 5.03 | 0.700 |
| Sum of posterior angles (°) | 395.36 ± 8.12 | 395.08 ± 4.20 | 0.879 |
| Anterior to posterior facial height (%) | 64.36 ± 6.58 | 63.48 ± 4.11 | 0.573 |
| Mp to Hp (°) | 26.76 ± 7.03 | 28.08 ± 5.57 | 0.465 |
| Genotype | Subject group, n (%) | Control group, n (%) | OR (95% CI) | P value |
|---|---|---|---|---|
| rs10850110 | ||||
| GG | 16 (64) | 13 (52) | Reference | |
| AG | 3 (12) | 8 (32) | 0.30 (0.042-1.66) | |
| AA | 6 (24) | 4 (16) | 1.22 (0.23-7.17) | 0.225 |
| AG+AA | 9 (36) | 12 (48) | 0.61 (0.17-2.19) | 0.390 |
| G | 35 (70) | 34 (68) | Reference | |
| A | 15 (30) | 16 (32) | 0.91 (0.39-2.13) | 0.829 |
| HWp | <0.001 | 0.186 | ||
| rs11611277 | ||||
| CC | 17 (68) | 19 (76) | Reference | |
| AC | 7 (28) | 6 (24) | 1.3 (0.31-5.58) | |
| AA | 1 (4) | 0 (0) | NA | 0.552 |
| AC+AA | 8 (32) | 6 (24) | 1.49 (0.36-6.18) | 0.529 |
| A | 41 (82) | 44 (88) | Reference | |
| C | 9 (18) | 6 (12) | 1.61 (0.53-4.92) | |
| HWp | 0.796 | 0.495 | 0.401 | |
| rs3825393 | ||||
| GG | 8 (32) | 16 (64) | Reference | |
| AG | 15 (60) | 6 (24) | 5 (1.19-22.20) | |
| AA | 2 (8) | 3 (12) | 1.33 (0.12-13.42) | 0.035 |
| AG+AA | 17 (68) | 9 (36) | 3.78 (1.01-14.63) | 0.024 |
| G | 31 (62) | 38 (76) | ||
| A | 19 (38) | 12 (24) | 1.94 (0.82-4.61) | 0.130 |
| HWp | 0.172 | 0.087 | ||
The pairwise LD measures (D′ and r 2 ) among the studied single nucleotide polymorphisms are depicted in the Figure . These polymorphisms were not in strong LD and formed no haplotype block, suggesting that a haplotype phenotype analysis may not give any information. The D′ value between rs10850110 and rs11611277 was 0.774, and the r 2 was 0.235, indicating weak LD. The D′ and r 2 values between rs10850110 and rs3825393 were 0.014 and 0.0 respectively, indicating no LD between these 2 markers. The distance between the first and second single nucleotide polymorphisms (rs10850110 and rs11611277) was ∼1.9 kilobases (kb), while the distance between the second and third single nucleotide polymorphisms (rs11611277 and rs3825393) was ∼56.7 kb. Similarly, the second and third markers also did not exhibit LD between them because the distance between them was 56.7 kb, indicating that rs3825393 single nucleotide polymorphism was conferring the risk independent of the other 2 polymorphisms. The haplotype phenotype association analysis also did not show any evidence of association (data not shown). The distributions of different cephalometric features and measures of growth pattern are documented in Table IV . All the continuous variables were compared between the different genotypes of the studied polymorphisms. No cephalometric variable or growth measure showed a statistical difference between the genotypes for the rs10850110 and rs11611277 single nucleotide polymorphisms. The SNB° angle showed significant differences among the different genotypes of rs3825393.
Stay updated, free dental videos. Join our Telegram channel
VIDEdental - Online dental courses
