Influence of TNF-α-308 G/A gene polymorphism on temporomandibular disorder

Introduction

Tumor necrosis factor alpha (TNF-α) levels are significantly upregulated in the synovial fluid of patients with temporomandibular joint disorder (TMD). The TNF-α influences pain generation and maintenance. Therefore, the aim of this study was to investigate the influence of single nucleotide polymorphism TNFA-308 (rs1800629) on TMD risk and on the pressure pain threshold.

Methods

The genotypic and allelic frequencies of candidate single nucleotide polymorphisms were compared among 152 TMD patients and 91 sex- and age-matched healthy subjects in the control group using the real-time polymerase chain reaction technique. The pressure pain threshold in the temporomandibular joint, anterior fascicle of the temporal muscle, masseter muscle, and Achilles tendon were recorded with an algometer. After the pressure test, all participants received a complete physical examination, including masticatory muscle evaluation, temporomandibular joint palpation, and assessment of mandibular range of motion.

Results

The TNFA-308 polymorphism is positively associated with TMD. Subjects with TMD had a 2.87 (95% confidence interval, 1.256-6.569) times greater chance of having the GA genotype than did the control group. Rare A-allele homozygotes demonstrated decreased pain sensitivity for the temporomandibular joint and anterior fascicle of the temporal muscle in the pressure pain threshold test compared with ancestral allele homozygotes.

Conclusions

This study presents an unprecedented association between the TNFA-308 (rs1800629) polymorphism and TMD. Future studies are needed to enlighten the association between TNFA-308 G/A single nucleotide polymorphism and mechanical pain sensitivity.

Highlights

  • •

    We present an unprecedented association between the TNF-α-308 polymorphism and temporomandibular disorder (TMD).

  • •

    Subjects with TMD had a 2.87 times greater chance of having the GA genotype than the control group.

  • •

    Rare A-allele homozygotes had decreased pain sensitivity for temporomandibular joint disorder and anterior fascicle of the temporal muscle than ancestral allele homozygotes.

Temporomandibular disorder (TMD) is a heterogeneous group of musculoskeletal disorders that affect the temporomandibular joint (TMJ), the masticatory muscles, and the neighboring structures of the TMJ. TMDs affect 5% to 15% of adults, are more prevalent in women between 20 and 40 years old, and cause billions of dollars in health care costs every year. According to project Orofacial Pain Prospective Evaluation and Risk Assessment, TMDs are associated with psychosocial factors, sleep apnea, history of trauma, parafunction, greater sensitivity to experimental pain, and other related painful disorders.

However, TMD pathophysiology is not yet fully understood. TMJ inflammation, peripheral and central sensitization, uncontrolled autonomic nervous system stimulation, and inefficient descending pain modulation are considered major risk factors that trigger and maintain the disorder. The complex and multifactorial nature of the pathology of TMDs suggests that environmental exposure and diverse genetic risk factors located in multiple loci could contribute to the disease pathogenesis.

Interestingly, chronic TMD is considered a functional somatic pain syndrome, similar to irritable bowel syndrome, migraines, fibromyalgia, interstitial cystitis, and chronic fatigue syndrome. Functional somatic syndromes have chronic pain of undetermined organic origin as their distinctive feature and tend to respond to antidepressant drug treatment and cognitive behavioral therapy. Furthermore, these seemingly unrelated conditions cumulatively affect certain persons, suggesting an underlying common etiologic factor. However, the exact pathophysiologic mechanisms explaining these conditions remain unknown but probably involve amplified pain perception, alterations in brain activity, or neuroendocrine and immunologic systems dysregulations, all of which could have a common genetic background.

The single nucleotide polymorphism (SNP) in the promoter region of the TNFA gene (responsible for codifying tumor necrosis factor alpha [TNF-α]) at position -308 (TNFA-308 G/A; rs1800629) could modulate the inflammatory response because rare A-allele carriers are associated with increased TNF-α production. Since TNF-α is strongly associated with various pain diseases and chronic pain defines functional somatic syndromes such as TMD, and the TNF-α levels are significantly upregulated in the synovial fluid of TMD patients, the aim of this study was to investigate the influence of SNP TNFA-308 (rs1800629) on TMD risk and in the pressure pain threshold.

Material and methods

The study protocol was approved by the Bauru School of Dentistry of the University of São Paulo’s ethics committee (protocol 118/2010) and was in accordance with the ethical principles of the World Medical Association’s Declaration of Helsinki. The study group was recruited from subjects seeking treatment at the dental clinic of the Bauru School of Dentistry. The recruitment strategy was not randomized by consecutive patients and enrolled 152 (136 female) TMD patients diagnosed according to the Guidelines for Diagnosis and Treatment of Orofacial Pain of the American Academy of Orofacial Pain. Patients diagnosed with articular disc displacement (with or without reduction), inflammatory articular disease, or masticatory muscle disorders (local myalgia, myofascial pain, and centrally mediated myalgia) were selected for the study. Regardless of the type of pathology, painful symptoms were mandatory for the subject to be included. The exclusion criteria were congenital or developing disorders (aplasia, hyperplasia, dysplasia, and neoplasm), neuropathies, burning mouth syndrome, toothache, and otitis. The control group comprised 91 sex- and age-matched healthy subjects (82 female). A basic assessment, including questionnaires and a clinical examination, was performed for all participants at recruitment.

The pressure pain threshold values in the TMJ, anterior fascicle of the temporal muscle, masseter muscle, and Achilles tendon (extra trigeminal site) were recorded with an algometer (Kratos Medical Supply, King of Prussia, Pa) equipped with a 1 cm 2 round tip calibrated at 0.5 kg per square centimeter per second applied perpendicular to the skin surface. The pressure was applied until it became painful. At this point, the participant was instructed to push a hand-held button attached to the algometer so that the device automatically recorded the amount of pressure. After the pressure tests, all participants received a complete physical examination, including masticatory muscle evaluation, TMJ palpation, and assessment of mandibular range of motion.

Saliva was collected from all participants at the enrollment session using a DNA Oragene OG-500 kit (DNA Genotek, Ottawa, Ontario, Canada) following the manufacturer’s instructions. DNA was extracted from each participant’s saliva using a commercially available QIAamp DNA Mini Kit (Qiagen, Hilden, Germany) according to the manufacturer’s guidelines. A spectrophotometer (Nanodrop 1000; Thermo Scientific, Waltham, Mass) was used to quantify and qualify the DNA samples. All isolated DNA samples were between 1.7 and 1.9 (260/280 nm ratio) and 1.9 and 2.1 (260/230 nm ratio). TNFA-308 genotyping was performed using a TaqMan SNP genotyping assay (Applied Biosystems, Foster City, Calif) containing a 20-times mix of unlabeled polymerase chain reaction forward and reverse primers (5′—AGGCAATAGGTTTTGAGGGCCAT-3′and 5-TCCTCCCTGCTCCGATTCCG-3′), as well VIC/FAM labeled allele discrimination probes (GAGGCAATAGGTTTTGAGGGGCATG[A/G]GGACGGGGTTCAGCCTCCAGGGTCC). Quantitative polymerase chain reaction was carried out in a 5-μL reaction mixture with 20 ng of genomic DNA and 2.5 μL of the TaqMan genotyping polymerase chain reaction master mix (Applied Biosystems). Amplification and detection were performed using the ViiA 7 platform (Applied Biosystems). Thermal cycling conditions were 10 minutes at 95°C followed by 45 cycles (2 steps), including 15 seconds of denaturation at 92°C and 60 seconds of annealing and extension at 60°C. All reactions were set manually in duplicate, and allele calling was done using SDS software (version 1.1; SDS Software, Bala Cynwyd, Pa).

Statistical analysis

The data distribution was tested by the Shapiro-Wilk normality test. The differences for the pressure pain thresholds between groups and for the different TNF-308 genotypes were assessed by unpaired t tests, Mann-Whitney U tests, analysis of variance, post hoc Bonferroni tests, or Kruskal-Wallis post hoc Dunn tests. The differences between polymorphism frequencies were assessed by the chi-square test. Risk factors for genotypes and alleles were estimated by calculation of odds ratios and 95% confidence intervals (95% CIs). Statistical significance was set at P < 0.05. All tests were performed using Prism software (version 5.01; GraphPad, San Diego, Calif). The study’s power calculation was performed with CATS software (Department of Biostatistics and Center for Statistical Genetics, University of Michigan, Ann Arbor) as previously described using multiplicative, additive, and dominant models.

Results

The mean ages for the TMD and control groups were 36 ± 11.00 years and 34 ± 11.47 years, respectively. There were no significant differences for age or sex distribution between the groups ( P = 0.354). Complete demographic information and clinical parameters for the study populations are shown in Tables I and II .

Table I
Baseline characteristics
Control, n = 91 (%) TMD, n = 152 (%) P value
Age (y) 34.68 ± 11.47 36.07 ± 11.00 0.623
Women (n) 82 (90%) 136 (89%) 0.354
Sleep bruxism (n) 18 (20%) 127 (83%) 0.000
History of orthodontic treatment (n) 41 (46%) 59 (39.9%) 0.312
Occlusal risk factors (n) 22 (25%) 35 (23%) 0.729

Table II
Clinical features of TMD patients
Feature Value
Onset of symptoms 5 years 9 months
VAS 1 (pain intensity at the clinical examination) 38
VAS 2 (worst pain in the last 30 days) 71
VAS 3 (mean pain in the last 30 days) 48
Concomitant functional pain syndromes (n) 22 (14%)
Self-medication (n) 86 (56%)
TMD diagnostic classification (n)
Arthralgia 68
Disc displacement with reduction 34
Disc displacement without reduction 10
Osteoarthritis 1
Localized myalgia 50
Central myalgia 1
Myofascial pain 99
VAS , Visual analog scale.

The pressure pain threshold was significantly lower in the TMD group than in the controls for the TMJ, the anterior fascicle of the temporal muscle, the masseter muscle, and the Achilles tendon ( Fig 1 ).

Fig 1
Pressure pain threshold in control and TMD groups. TMJ , Temporomandibular joint; AFMT , anterior fascicle temporal muscle; MM , masseter muscle; AcT , Achilles tendon. * P <0.05.

The genotype and allele frequencies of the investigated polymorphisms were in Hardy-Weinberg equilibrium. The TNFA-308 polymorphism is positively associated with TMD because 26.97% of TMD patients have the rare A-allele, whereas it was found in just 13.18% of healthy patients, with an odds ratio of 2.454 (95% CI, 1.212-4968). Subjects suffering from TMD had a 2.87 (95% CI, 1.256-6.569) times greater chance of having the GA genotype for the TNF-308 polymorphism than the control group ( Table III ). From the genetic viewpoint, the study power calculation demonstrated (performed with 0.05-0.15 values for prevalence, 0.16 for disease allele frequency, and 2.45 for genotype relative risk) the trustworthiness of the study because of the power values of 99% to 100% for the multiplicative model, 96% to 99% for the additive model, and 90% to 96% for the dominant model.

Table III
Genotype and allele frequencies for SNP TNFA-308 (rs1800629) of the groups
Control, n = 91 (%) TMD, n = 152 (%) P value OR (95% CI)
Genotype
GG 79 (86.81) 111 (73.02)
GA 8 (8.79) 32 (21.05) 0.0116 ∗ 2.873 (1.256-6.569)
AA 4 (4.4) 9 (5.93) 0.5649 1.616 (0.4804-5.435)
GA + AA 12 (13.18) 41 (26.97) 0.0107 ∗ 2.454 (1.212-4.698)
Allele distribution
G 166 (91.2) 254 (83.55)
A 16 (8.8) 50 (16.45) 0.3087 1.427 (0.779-2.612)
OR , Odds ratio.

∗ P <0.05.

Intriguingly, rare A-allele homozygotes demonstrated decreased pain sensitivity for TMJ and the anterior fascicle of the temporal muscle in the pressure pain threshold test compared with ancestral allele homozygotes. When A-allele carriers (AA + GA) where clustered together and compared with the ancestral G-allele carriers, there was no statistical difference between groups for pain response ( Fig 2 ).

Apr 4, 2017 | Posted by in Orthodontics | Comments Off on Influence of TNF-α-308 G/A gene polymorphism on temporomandibular disorder

VIDEdental - Online dental courses

Get VIDEdental app for watching clinical videos