Mechanistic, genomic and proteomic study on the effects of BisGMA-derived biodegradation product on cariogenic bacteria

Highlights

  • •

    A BisGMA-derived degradation product affects gene expression of cariogenic bacteria.

  • •

    Resin composite degradation product affects gene expression of cariogenic bacteria.

  • •

    A BisGMA-derived biodegradation product affects virulence of S. mutans .

  • •

    Resin composite biodegradation product affects virulence of S. mutans .

  • •

    A BisGMA-derived biodegradation product regulates biofilms-related proteins/enzymes.

Abstract

Objectives

Investigate the effects of a Bis-phenyl-glycidyl-dimethacrylate (BisGMA) biodegradation product, bishydroxypropoxyphenyl-propane (BisHPPP), on gene expression and protein synthesis of cariogenic bacteria.

Methods

Quantitative real-time polymerase chain reaction was used to investigate the effects of BisHPPP on the expression of specific virulence-associated genes, i.e. gtfB , gtfC , gbpB , comC , comD , comE and atpH in Streptococcus mutans UA159. Possible mechanisms for bacterial response to BisHPPP were explored using gene knock-out and associated complemented strains of the signal peptide encoding gene, comC . The effects of BisHPPP on global gene and protein expression was analyzed using microarray and quantitative proteomics. The role of BisHPPP in glucosyltransferase (GTF) enzyme activity of S. mutans biofilms was also measured.

Results

BisHPPP (0.01, 0.1 mM) up-regulated gtfB/C , gbpB , comCDE , and atpH most pronounced in biofilms at cariogenic pH (5.5). The effects of BisHPPP on the constructed knock-out and complemented strains of comC from quorum-sensing system, implicated this signaling pathway in up-regulation of the virulence-associated genes. Microarray and proteomics identified BisHPPP-regulated genes and proteins involved in biofilm formation, carbohydrate transport, acid tolerance and stress-response. GTF activity was higher in BisHPPP-exposed biofilms when compared to no-BisHPPP conditions.

Significance

These findings provide insight into the genetic and physiological pathways and mechanisms that help explain S. mutans adaptation to restorative conditions that are conducive to increased secondary caries around resin composite restorations and may provide guidance to clinicians’ decision on the selection of dental materials when considering the long term oral health of patients and the interactions of composite resins with oral bacteria.

Introduction

Resin composites are currently the most widely-used restorative materials in dentistry. While providing several beneficial properties over amalgam such as superior esthetics and excellent adhesive strength to dentin and enamel, resin composites experience significant biological breakdown in the oral cavity. These processes result in an increased rate of recurrent/secondary caries and reduced restoration longevity compared to amalgam . Furthermore, two most recent systematic reviews suggested that resin composite restorations in posterior teeth have shorter service life and suffer from a higher number of secondary caries when compared to amalgam restorations . Biodegradation of the resin composites and adhesives in vivo is one of the major contributors to the cascade of events leading to composite restoration failure associated with recurrent/secondary caries , and impacting clinical and economical outcomes .

Bis-phenyl glycidyl dimethacrylate (BisGMA) is a universal monomer used extensively in dental restorative materials such as dental composites and adhesives . The ester linkages contained within this monomer render the dental composites and adhesives susceptible to hydrolytic degradation, which can be catalysed by salivary and bacterial esterases. The hydrolysis produces the biodegradation by-product (BBP) bishydroxypropoxyphenyl-propane (BisHPPP) . Degradation of the tooth-restoration interfaces can facilitate infiltration of cariogenic bacteria into the margins and contribute to the progression of recurrent caries .

Streptococcus mutans is the most cariogenic of all the oral streptococci and is one of the leading species associated with human dental caries . S. mutans has been used in in vitro models to identify candidate molecular pathways relevant to resin composite restoration failure . The present study builds upon our previous reports that showed regulation of gene expression for gtfB (a known virulence factor) and yfiV (a putative transcriptional regulator) by BBPs in S. mutans NG8 . The latter studies demonstrated the need to further examine the relationship between BBPs and gene expression in S. mutans , and directing further work toward understanding the S. mutans genetic and physiological response after exposure to BBPs from dental composite and adhesives. While there is extensive evidence supporting the cytotoxic, genotoxic and estrogenic effects of dental resin monomers on both mammalian and bacterial cells, there are only a few studies reporting the biological effects of the BBPs from these monomers, despite their long-term release from the bulk of the restoration and from the adhesive within the critical interface .

Here the effects of BBPs on S. mutans virulence-associated gene and protein expression were further investigated. Since S. mutans UA159 genome has been fully sequenced and annotated, comprehensive gene expression analysis is possible . Thus it was decided to chose this strain for the present study. First, the effect of the BisGMA-derived universal degradation product, BisHPPP, on the expression of seven established key virulence genes in S. mutans UA159 i.e. gtfB , gtfC , gbpB , comC , comD , comE and atpH was investigated. GtfB and gtfC encode glucosyltransferase (GTF) enzymes involved in the synthesis of water-insoluble glucan that together with glucan binding protein (encoded by gbpB ) facilitate bacterial adhesion to the tooth surface. ComCDE are involved in quorum-sensing and atpH encodes subunit C of a multi-subunit enzyme (F1F0-ATPase) involved in intracellular pH regulation and acid tolerance. The selected genes have unique virulence properties in S. mutans and have been linked to its cariogenicity by previous animal and human studies . Second, the potential signaling pathways underlying these effects were explored by using knock-out and complemented strains of the key regulatory gene, comC , a component of quorum-sensing system. Quorum-sensing is an integral component of bacterial global gene regulatory networks responsible for bacterial adaptation in biofilms . This system has been shown to have a positive regulatory effect on the expression of biofilm-related genes including gtfB , gtfC , gbpB and acid tolerance in S. mutans . It was also desired to define other candidate pathways involved in S. mutans cariogenic potential after exposure to BisHPPP, using microarray and quantitative proteomics analyses in an in vitro biofilm model. Finally, the effect of BisHPPP on S. mutans GTF enzyme activity was measured to assess the effect of BisHPPP on the synthesis of water-insoluble exopolysaccharide glucan, a known virulence factor in S. mutans .

The current study is the first investigation relating possible underlying signalling pathways and their effect on S. mutans virulence factor expression, to the presence of BBPs. This is of importance with regards to unraveling molecular mechanisms associated with recurrent caries around resin composite restorations.

Materials & methods

Bacterial strains and growth conditions

S. mutans UA159 wild-type strain was obtained from Dr. Arnold Bleiweis (University of Florida) and stored in 15% (v/v) glycerol (3 mL of 50% glycerol in Todd-Hewitt Yeast Extract broth was added to 7 mL of overnight bacterial culture) at −80 °C. To construct the comC -deficient mutant strain (SMΔcomC1), a PCR-ligation mutagenesis strategy was used as previously described . The comC complemented strain (SMΔcomC1C) was made using pIB166 plasmid that contained the S. mutans recombinant comC as described previously . The primers used for the comC deletion and complementation constructs are listed in Table 1 (Operon, AL, USA). The S. mutans wild-type strain was sub-cultured on Todd-Hewitt agar plate supplemented with 0.3% yeast extract (THYE) (BBL; Becton Dickenson, Cockeysville, MD, USA), whereas the comC mutant was maintained on THYE agar containing 10 μg of erythromycin/mL . All S. mutans overnight cultures were routinely grown in THYE broth at 37 °C in a 5% CO 2 –95% air mixtures. In order to investigate the differential effects of BisHPPP on S. mutans gene/protein expression at neutral (pH 7.0) and cariogenic pH (pH 5.5), the first set of experiments (qRT-PCR) were carried out at both pHs.

Table 1
Primers used for construction of comC knock-out and complemented strains.
Primer use and name Nucleotide sequence
Primers for comC deletion:
comC-P1 TACAAAGCAAATCTGAACAAG
comC-P2 GGCGCGCCTGATAATCTCTAATTCATC
comC-P3 GGCCGGCCAAGCGGAAGCCTATCAAC
comC-P4 AAACGATGCTGTCAAGGG
Erm cst-F GG^CGCGCCCCGGGCCCAAAATTTGTTTGAT
Erm cst-B GGCCGG^CCAGTCGGCAGCGACTCATAGAAT
Primers for comC complementation:
comC F(ApaI) GGGGGCCCACCTGCTGCACAATTCCA
comC R(ClaI) GATCGATGAGGAGGCCTATTCTCTAAG

Preparation of planktonic cells

Overnight cultures of S. mutans UA159 were diluted (1:10) in TYEG medium containing tryptone (10 g/L), yeast extract (5 g/L) and glucose (5 mM) buffered either at pH 5.5 with 100 mM MES (2-( N -Morpholino)-ethanesulfonic acid, Sigma–Aldrich, St. Louis, MO, USA) or at pH 7.0 with 100 mM MOPS (3-( N -Morpholino) propanesulfonic acid, Bioshop, Burlington, ON, Canada), to control pH, supplemented with 0.1% glucose and 500 μL of the appropriate amount of sterile filtered BisHPPP (99.9% pure, Sigma–Aldrich) yielding final concentrations of 0, 0.001, 0.01, 0.1 mM BisHPPP in the solutions . The culture tubes were incubated at 37 °C in a 5% CO 2 –95% air mixtures. Bacterial cell density was monitored using a UV spectrophotometer (Ultraspec 3000, Biotech) at 600 nm in order to ensure that the cultures were harvested once they reached mid-logarithmic phase (optical density or OD = 0.4). The pH of sample cultures was verified (H135 minilab™ pro, HACH, Germany). This was followed by centrifugation at 2300 × g for 10 min (4 °C). The supernatants were discarded and the pellets were snap frozen in liquid nitrogen and stored at −80 °C until required for RNA isolation.

Preparation of biofilm cells

Overnight cultures of S. mutans UA159 were diluted (1:60) in TYEG medium and added to six-well polystyrene microtiter plates (Fisher Scientific). Each well containing 3 mL of ¼ strength TYEG medium buffered to pH 5.5 or 7.0 and 50 μL of overnight culture were supplemented with 0.1% glucose and 500 μL of BisHPPP stock solutions as described for planktonic conditions above. Cells were then incubated for 18 h (37 °C, 5% CO 2 ) after which the pH of sample cultures was confirmed. Then, the liquid contents were removed and 3 mL of phosphate buffer (PBS) was slowly added to each well and gently stirred to remove loosely attached cells, leaving only adhered biofilm cells. The remaining PBS was then removed and replaced with 1 mL of fresh PBS. Biofilm cells from each well were scraped and the resulting cell suspensions from each well were transferred to 50 mL tubes and centrifuged at 2300 × g for 10 min at 4 °C. The supernatants were then discarded and the pellets were snap frozen in liquid nitrogen and stored at −80 °C until required for RNA isolation.

Gene expression analysis using qRT-PCR

Total RNA was isolated by disruption of S. mutans UA159 cells using the 120 cell disrupter (Thermo Savant, Fast-Prep FP 101), followed by DNase treatment of the RNA samples and cDNA synthesis as described before . QRT-PCR was used to quantify the relative gene expression of selected genes: gtfB , gtfC , gbpB , comC , comD , comE and atpH as previously described . The primers used are presented in Table 2 (Operon, AL, USA). Quantitative gene expression data were then normalized to the 16S rRNA, a well-established housekeeping gene . The level of 16S rRNA message was not affected by various concentrations of BisHPPP (data not shown). QRT-PCR gene expression analysis was also employed to investigate the involvement of the comCDE system in regulation of the seven S. mutans virulence genes in the presence of BisHPPP. Using the comC knock-out (SMΔcomC1) and complemented (SMΔcomC1C) strains, gene expression analysis was repeated for three representative genes, gtfB (biofilm formation), comD (quorum sensing) and atpH (acid tolerance), each representing a functional category of virulence genes. For statistical analysis, one-way analysis of variance (ANOVA) and Tukey post hoc analyses were performed to determine the differences in gene expression between different concentrations BisHPPP and the no-BisHPPP control within each growth mode (P < 0.05). Two-way ANOVA and Tukey post-hoc analyses were conducted to validate differences in gene expression between growth modes (biofilm vs. planktonic) at the same concentration (P < 0.05). Homogeneity of variance and normality were verified with Leven’s and Shapiro-Wilk tests, respectively. A fold change in gene expression more than 2 (up-regulation) and less than 0.5 (down-regulation) with a P-value cut-off of <0.05 were considered physiologically significant . All qRT-PCR reactions were run in triplicate for each experimental condition and the experiments were reproduced four separate times using four independent cultures.

Table 2
Nucleotide sequence of primers used for qRT-PCR.
Gene Description Primer sequence (5′–3′)
Forward Reverse
gtfB GTF I, glucan production ACACTTTCGGGTGGCTTG GCTTAGATGTCACTTCGGTTG
gtfC GTF II, glucan production CCAAAATGGTATTATGGCTGTCG GAGTCTCTATCAAAGTAACGCAGT
gbpB Glucan binding protein AGCAACAGAAGCACAACCATCAG CCACCATTACCCCAGTAGTTTCC
comC Competence-stimulating peptide GACTTTAAAGAAATTAAGACTG AAGCTTGTGTAAAACTTCTGT
comD Two-component regulatory system CTCTGATTGACCATTCTTCTGG CATTCTGAGTTTATGCCCCTC
comE Two-component regulatory system CCTGAAAAGGGCAATCACCAG GGGGCATAAACTCAGAATGTGTCG
atpH Acid tolerance ACCATACATTTCAGGCTG TTTTAGCACTTGGGATTG
16S r RNA Normalizing internal standard CTTACCAGGTCTTGACATCCCG ACCCAACATCTCACGACACGAG

Microarray analysis

Total RNA was isolated by disruption of S. mutans UA159 biofilms from both experimental (0.01, 0.1 and 1.0 mM) and control (no BisHPPP) groups using the 120 Cell disrupter (Thermo Savant, Fast-Prep FP 101) followed by DNase treatment of the RNA samples and cDNA synthesis as described previously . S. mutans UA159 microarray slides designed by Dr. Dragana Ajdic, were used (Affymetrix, Santa Clara, CA). The S. mutans microarray processing including hybridization, washing and scanning of microarray slides, were performed according to the procedures described by Affymetrix and conducted by The Center for Applied Genomics, (Hospital for Sick Children Research Institute, Toronto, Ontario, Canada). Data was first checked for overall quality using R (v2.15.2) with the Bioconductor framework and the Array Quality Metrics package. Microarray data processing and analysis employed the operating software. Statistically significant genes were then identified using a class comparison analysis (GeneSpring v12.6, Agilent technologies, Santa Clara, CA, USA). An analysis of variance (ANOVA) with the parametric P-value cut off set at <0.05 was used for statistical analysis. Specific comparisons among the different concentrations in each group was done by a post-hoc Tukey’s test. A fold change in gene expression >1.5 (up-regulation) and <0.5 (down-regulation) with a P-value cut-off of <0.05 were considered significant . All study groups were run 3 separate times with 4 independent samples (using 4 independent S. mutans cultures) in each group.

Proteomic analysis

Sample preparation for mass spectrometry

Biofilms from both experimental (0.01, 0.1 and 1.0 mM) and control (no BisHPPP) groups were washed twice in cold PBS and re-suspended in 1 mL of PBS buffer. The cells were disrupted using a homogenizer (Thermo Savant, FastPrep FP 101) for 45 s and then centrifuged at 15,700 × g for 1 min. Supernatant was carefully removed, separated in aliquots of 50 μL and stored at −80 °C. The total protein concentration in each sample was assessed by the Micro Bicinchoninic Acid (Micro BCA) assay . Equal amounts of protein (20 μg) from both experimental and control groups were dried by a rotary evaporator, denatured and reduced for 2 h by the addition of 200 μL of 4 M urea, 10 mM dithiothreitol (DTT), and 50 mM NH 4 HCO 3 , pH 7.8. After four-fold dilution with 50 mM NH 4 HCO 3 , pH 7.8, tryptic digestion was carried out for 18 h at 37 °C, following the addition of 2% (w/w) sequencing-grade trypsin (Promega, Madison, WI, USA). All study groups were run 3 separate times to increase coverage of the samples and identify more proteins, with 4 independent samples (using 4 independent S. mutans cultures) in each group.

Liquid chromatography electrospray ionization tandem mass spectrometry (LC–ESI-MS/MS) and relative proteome quantitation

Peptide separation and mass spectrometric analyses were carried out as described previously . The obtained MS/MS spectra were searched against a streptococci protein database (Swiss Prot and TrEMBL, Swiss Institute of Bioinformatics, Geneva, Switzerland, http://ca.expasy.org/sprot/ ) using SEQUEST algorithm in Proteome Discoverer 1.3 software (Thermo Scientific, San Jose, CA, USA). .

For quantitative proteome analysis, three MS raw files from each group (control and experimental groups) for a total of 12 MS raw files were analyzed using SIEVE software (Version 2.0 Thermo Scientific, San Jose, CA, USA) . For the alignment step, a single MS raw file belonging to the control group (no BisHPPP) was selected as the benchmark and all of the other files were adjusted to generate the best correlation to this reference file. After alignment, the feature detection and integration (or framing) process was performed using the MS level data. For statistical analyses of protein abundance, peak integrations were summarized into protein-level annotation in SIEVE using a weighted average of intensities of LC–ESIMS/MS for each protein. In addition, a statistical model based on an ANOVA framework with Tukey’s post hoc test was carried out. Relative abundance of an individual protein from different BisHPPP concentration groups was considered significantly different from the control group (no BisHPPP) when the values observed were >1.5 for increased and <0.5 for decreased abundance with a P-value cut-off of <0.05 .

Correlation analysis

For correlation analysis between microarray and proteomics data both data sets were merged by cross-referencing the sequence identifier, which was “Gene Symbol” in gene expression data and “Gene Name” in the protein data. In total 38 unique genes had both gene expression and protein abundance data. A Pearson estimate and a non-parametric estimate (Spearman) were used to detect any correlation between gene expression and proteomics data with the P-value cut-off set at <0.05.

GTF enzyme activity assay

GTF enzyme activity was measured by determining the rate that [ 14 C]-sucrose was converted to glucan polymers by GTF, which cleaves the sucrose into fructose and glucose that are added to the growing exopolysaccharide . Briefly, S. mutans UA159 biofilm was grown in a 6-well polystyrene microtiter plate containing ¼ TYEG medium buffered to pH 5.5. Appropriate amounts of BisHPPP were added to the medium to yield the target final concentrations (0, 0.01, 0.1 and 1.0 mM). Overnight cultures were added to the mixture and incubated for 18 h. Bacterial cells were collected, transferred to tubes and pelleted by centrifugation at 2300 × g and 4 °C for 10 min. The supernatant was then removed/discarded and the pellets were washed twice in cold PBS and re-suspended in 1 mL of PBS buffer. The cells were disrupted (Thermo Savant, FastPrep FP 101) for 45 s and then centrifuged at 15,700 × g for 1 min. Separate aliquots of the supernatant were carefully removed and stored separately at −80 °C. Total protein concentration in each sample was assessed by the Micro BCA assay described above . 15 μg of protein from both experimental and control groups was added to 0.2 M potassium phosphate buffer (pH 6.8) for a total volume of 20 μL, this solution was mixed with 20 μL of 14 C-radiolabelled reaction buffer containing 0.2 M KPO 4 (pH 6.8), 20 mM sucrose, and 10 μL/mL 14 C-sucrose (24.4 GBq/mmol; Amersham). The mixture was incubated at 37 °C for 60 min after which the reaction mixtures were adsorbed onto 25 mm filters (0.22 μm GVWP; Millipore). The samples were then air dried for 20 min and washed three times with 2 mL distilled water to remove the water-soluble glucan and serve only as water-insoluble glucan samples. The water-insoluble glucan, mainly synthesized by GtfB and GtfC enzymes. The samples were then placed in 5 mL scintillation fluid (ScintiSafe Econo 2 Cocktail; Fisher) and synthesized [ 14 C]-glucan was measured using a liquid scintillation counter (Beckman LS6500). Homogeneity of variance and normality were verified with Leven’s and Shapiro-Wilk tests, respectively. One way ANOVA and Tukey post hoc analyses were used to determine significant changes in GTF activity between the different groups (P < 0.05). All study groups were run 3 separate times with 4 independent samples (using 4 independent S. mutans cultures) in each group.

Materials & methods

Bacterial strains and growth conditions

S. mutans UA159 wild-type strain was obtained from Dr. Arnold Bleiweis (University of Florida) and stored in 15% (v/v) glycerol (3 mL of 50% glycerol in Todd-Hewitt Yeast Extract broth was added to 7 mL of overnight bacterial culture) at −80 °C. To construct the comC -deficient mutant strain (SMΔcomC1), a PCR-ligation mutagenesis strategy was used as previously described . The comC complemented strain (SMΔcomC1C) was made using pIB166 plasmid that contained the S. mutans recombinant comC as described previously . The primers used for the comC deletion and complementation constructs are listed in Table 1 (Operon, AL, USA). The S. mutans wild-type strain was sub-cultured on Todd-Hewitt agar plate supplemented with 0.3% yeast extract (THYE) (BBL; Becton Dickenson, Cockeysville, MD, USA), whereas the comC mutant was maintained on THYE agar containing 10 μg of erythromycin/mL . All S. mutans overnight cultures were routinely grown in THYE broth at 37 °C in a 5% CO 2 –95% air mixtures. In order to investigate the differential effects of BisHPPP on S. mutans gene/protein expression at neutral (pH 7.0) and cariogenic pH (pH 5.5), the first set of experiments (qRT-PCR) were carried out at both pHs.

Table 1
Primers used for construction of comC knock-out and complemented strains.
Primer use and name Nucleotide sequence
Primers for comC deletion:
comC-P1 TACAAAGCAAATCTGAACAAG
comC-P2 GGCGCGCCTGATAATCTCTAATTCATC
comC-P3 GGCCGGCCAAGCGGAAGCCTATCAAC
comC-P4 AAACGATGCTGTCAAGGG
Erm cst-F GG^CGCGCCCCGGGCCCAAAATTTGTTTGAT
Erm cst-B GGCCGG^CCAGTCGGCAGCGACTCATAGAAT
Primers for comC complementation:
comC F(ApaI) GGGGGCCCACCTGCTGCACAATTCCA
comC R(ClaI) GATCGATGAGGAGGCCTATTCTCTAAG

Preparation of planktonic cells

Overnight cultures of S. mutans UA159 were diluted (1:10) in TYEG medium containing tryptone (10 g/L), yeast extract (5 g/L) and glucose (5 mM) buffered either at pH 5.5 with 100 mM MES (2-( N -Morpholino)-ethanesulfonic acid, Sigma–Aldrich, St. Louis, MO, USA) or at pH 7.0 with 100 mM MOPS (3-( N -Morpholino) propanesulfonic acid, Bioshop, Burlington, ON, Canada), to control pH, supplemented with 0.1% glucose and 500 μL of the appropriate amount of sterile filtered BisHPPP (99.9% pure, Sigma–Aldrich) yielding final concentrations of 0, 0.001, 0.01, 0.1 mM BisHPPP in the solutions . The culture tubes were incubated at 37 °C in a 5% CO 2 –95% air mixtures. Bacterial cell density was monitored using a UV spectrophotometer (Ultraspec 3000, Biotech) at 600 nm in order to ensure that the cultures were harvested once they reached mid-logarithmic phase (optical density or OD = 0.4). The pH of sample cultures was verified (H135 minilab™ pro, HACH, Germany). This was followed by centrifugation at 2300 × g for 10 min (4 °C). The supernatants were discarded and the pellets were snap frozen in liquid nitrogen and stored at −80 °C until required for RNA isolation.

Preparation of biofilm cells

Overnight cultures of S. mutans UA159 were diluted (1:60) in TYEG medium and added to six-well polystyrene microtiter plates (Fisher Scientific). Each well containing 3 mL of ¼ strength TYEG medium buffered to pH 5.5 or 7.0 and 50 μL of overnight culture were supplemented with 0.1% glucose and 500 μL of BisHPPP stock solutions as described for planktonic conditions above. Cells were then incubated for 18 h (37 °C, 5% CO 2 ) after which the pH of sample cultures was confirmed. Then, the liquid contents were removed and 3 mL of phosphate buffer (PBS) was slowly added to each well and gently stirred to remove loosely attached cells, leaving only adhered biofilm cells. The remaining PBS was then removed and replaced with 1 mL of fresh PBS. Biofilm cells from each well were scraped and the resulting cell suspensions from each well were transferred to 50 mL tubes and centrifuged at 2300 × g for 10 min at 4 °C. The supernatants were then discarded and the pellets were snap frozen in liquid nitrogen and stored at −80 °C until required for RNA isolation.

Gene expression analysis using qRT-PCR

Total RNA was isolated by disruption of S. mutans UA159 cells using the 120 cell disrupter (Thermo Savant, Fast-Prep FP 101), followed by DNase treatment of the RNA samples and cDNA synthesis as described before . QRT-PCR was used to quantify the relative gene expression of selected genes: gtfB , gtfC , gbpB , comC , comD , comE and atpH as previously described . The primers used are presented in Table 2 (Operon, AL, USA). Quantitative gene expression data were then normalized to the 16S rRNA, a well-established housekeeping gene . The level of 16S rRNA message was not affected by various concentrations of BisHPPP (data not shown). QRT-PCR gene expression analysis was also employed to investigate the involvement of the comCDE system in regulation of the seven S. mutans virulence genes in the presence of BisHPPP. Using the comC knock-out (SMΔcomC1) and complemented (SMΔcomC1C) strains, gene expression analysis was repeated for three representative genes, gtfB (biofilm formation), comD (quorum sensing) and atpH (acid tolerance), each representing a functional category of virulence genes. For statistical analysis, one-way analysis of variance (ANOVA) and Tukey post hoc analyses were performed to determine the differences in gene expression between different concentrations BisHPPP and the no-BisHPPP control within each growth mode (P < 0.05). Two-way ANOVA and Tukey post-hoc analyses were conducted to validate differences in gene expression between growth modes (biofilm vs. planktonic) at the same concentration (P < 0.05). Homogeneity of variance and normality were verified with Leven’s and Shapiro-Wilk tests, respectively. A fold change in gene expression more than 2 (up-regulation) and less than 0.5 (down-regulation) with a P-value cut-off of <0.05 were considered physiologically significant . All qRT-PCR reactions were run in triplicate for each experimental condition and the experiments were reproduced four separate times using four independent cultures.

Table 2
Nucleotide sequence of primers used for qRT-PCR.
Gene Description Primer sequence (5′–3′)
Forward Reverse
gtfB GTF I, glucan production ACACTTTCGGGTGGCTTG GCTTAGATGTCACTTCGGTTG
gtfC GTF II, glucan production CCAAAATGGTATTATGGCTGTCG GAGTCTCTATCAAAGTAACGCAGT
gbpB Glucan binding protein AGCAACAGAAGCACAACCATCAG CCACCATTACCCCAGTAGTTTCC
comC Competence-stimulating peptide GACTTTAAAGAAATTAAGACTG AAGCTTGTGTAAAACTTCTGT
comD Two-component regulatory system CTCTGATTGACCATTCTTCTGG CATTCTGAGTTTATGCCCCTC
comE Two-component regulatory system CCTGAAAAGGGCAATCACCAG GGGGCATAAACTCAGAATGTGTCG
atpH Acid tolerance ACCATACATTTCAGGCTG TTTTAGCACTTGGGATTG
16S r RNA Normalizing internal standard CTTACCAGGTCTTGACATCCCG ACCCAACATCTCACGACACGAG

Microarray analysis

Total RNA was isolated by disruption of S. mutans UA159 biofilms from both experimental (0.01, 0.1 and 1.0 mM) and control (no BisHPPP) groups using the 120 Cell disrupter (Thermo Savant, Fast-Prep FP 101) followed by DNase treatment of the RNA samples and cDNA synthesis as described previously . S. mutans UA159 microarray slides designed by Dr. Dragana Ajdic, were used (Affymetrix, Santa Clara, CA). The S. mutans microarray processing including hybridization, washing and scanning of microarray slides, were performed according to the procedures described by Affymetrix and conducted by The Center for Applied Genomics, (Hospital for Sick Children Research Institute, Toronto, Ontario, Canada). Data was first checked for overall quality using R (v2.15.2) with the Bioconductor framework and the Array Quality Metrics package. Microarray data processing and analysis employed the operating software. Statistically significant genes were then identified using a class comparison analysis (GeneSpring v12.6, Agilent technologies, Santa Clara, CA, USA). An analysis of variance (ANOVA) with the parametric P-value cut off set at <0.05 was used for statistical analysis. Specific comparisons among the different concentrations in each group was done by a post-hoc Tukey’s test. A fold change in gene expression >1.5 (up-regulation) and <0.5 (down-regulation) with a P-value cut-off of <0.05 were considered significant . All study groups were run 3 separate times with 4 independent samples (using 4 independent S. mutans cultures) in each group.

Proteomic analysis

Sample preparation for mass spectrometry

Biofilms from both experimental (0.01, 0.1 and 1.0 mM) and control (no BisHPPP) groups were washed twice in cold PBS and re-suspended in 1 mL of PBS buffer. The cells were disrupted using a homogenizer (Thermo Savant, FastPrep FP 101) for 45 s and then centrifuged at 15,700 × g for 1 min. Supernatant was carefully removed, separated in aliquots of 50 μL and stored at −80 °C. The total protein concentration in each sample was assessed by the Micro Bicinchoninic Acid (Micro BCA) assay . Equal amounts of protein (20 μg) from both experimental and control groups were dried by a rotary evaporator, denatured and reduced for 2 h by the addition of 200 μL of 4 M urea, 10 mM dithiothreitol (DTT), and 50 mM NH 4 HCO 3 , pH 7.8. After four-fold dilution with 50 mM NH 4 HCO 3 , pH 7.8, tryptic digestion was carried out for 18 h at 37 °C, following the addition of 2% (w/w) sequencing-grade trypsin (Promega, Madison, WI, USA). All study groups were run 3 separate times to increase coverage of the samples and identify more proteins, with 4 independent samples (using 4 independent S. mutans cultures) in each group.

Liquid chromatography electrospray ionization tandem mass spectrometry (LC–ESI-MS/MS) and relative proteome quantitation

Peptide separation and mass spectrometric analyses were carried out as described previously . The obtained MS/MS spectra were searched against a streptococci protein database (Swiss Prot and TrEMBL, Swiss Institute of Bioinformatics, Geneva, Switzerland, http://ca.expasy.org/sprot/ ) using SEQUEST algorithm in Proteome Discoverer 1.3 software (Thermo Scientific, San Jose, CA, USA). .

For quantitative proteome analysis, three MS raw files from each group (control and experimental groups) for a total of 12 MS raw files were analyzed using SIEVE software (Version 2.0 Thermo Scientific, San Jose, CA, USA) . For the alignment step, a single MS raw file belonging to the control group (no BisHPPP) was selected as the benchmark and all of the other files were adjusted to generate the best correlation to this reference file. After alignment, the feature detection and integration (or framing) process was performed using the MS level data. For statistical analyses of protein abundance, peak integrations were summarized into protein-level annotation in SIEVE using a weighted average of intensities of LC–ESIMS/MS for each protein. In addition, a statistical model based on an ANOVA framework with Tukey’s post hoc test was carried out. Relative abundance of an individual protein from different BisHPPP concentration groups was considered significantly different from the control group (no BisHPPP) when the values observed were >1.5 for increased and <0.5 for decreased abundance with a P-value cut-off of <0.05 .

Correlation analysis

For correlation analysis between microarray and proteomics data both data sets were merged by cross-referencing the sequence identifier, which was “Gene Symbol” in gene expression data and “Gene Name” in the protein data. In total 38 unique genes had both gene expression and protein abundance data. A Pearson estimate and a non-parametric estimate (Spearman) were used to detect any correlation between gene expression and proteomics data with the P-value cut-off set at <0.05.

GTF enzyme activity assay

GTF enzyme activity was measured by determining the rate that [ 14 C]-sucrose was converted to glucan polymers by GTF, which cleaves the sucrose into fructose and glucose that are added to the growing exopolysaccharide . Briefly, S. mutans UA159 biofilm was grown in a 6-well polystyrene microtiter plate containing ¼ TYEG medium buffered to pH 5.5. Appropriate amounts of BisHPPP were added to the medium to yield the target final concentrations (0, 0.01, 0.1 and 1.0 mM). Overnight cultures were added to the mixture and incubated for 18 h. Bacterial cells were collected, transferred to tubes and pelleted by centrifugation at 2300 × g and 4 °C for 10 min. The supernatant was then removed/discarded and the pellets were washed twice in cold PBS and re-suspended in 1 mL of PBS buffer. The cells were disrupted (Thermo Savant, FastPrep FP 101) for 45 s and then centrifuged at 15,700 × g for 1 min. Separate aliquots of the supernatant were carefully removed and stored separately at −80 °C. Total protein concentration in each sample was assessed by the Micro BCA assay described above . 15 μg of protein from both experimental and control groups was added to 0.2 M potassium phosphate buffer (pH 6.8) for a total volume of 20 μL, this solution was mixed with 20 μL of 14 C-radiolabelled reaction buffer containing 0.2 M KPO 4 (pH 6.8), 20 mM sucrose, and 10 μL/mL 14 C-sucrose (24.4 GBq/mmol; Amersham). The mixture was incubated at 37 °C for 60 min after which the reaction mixtures were adsorbed onto 25 mm filters (0.22 μm GVWP; Millipore). The samples were then air dried for 20 min and washed three times with 2 mL distilled water to remove the water-soluble glucan and serve only as water-insoluble glucan samples. The water-insoluble glucan, mainly synthesized by GtfB and GtfC enzymes. The samples were then placed in 5 mL scintillation fluid (ScintiSafe Econo 2 Cocktail; Fisher) and synthesized [ 14 C]-glucan was measured using a liquid scintillation counter (Beckman LS6500). Homogeneity of variance and normality were verified with Leven’s and Shapiro-Wilk tests, respectively. One way ANOVA and Tukey post hoc analyses were used to determine significant changes in GTF activity between the different groups (P < 0.05). All study groups were run 3 separate times with 4 independent samples (using 4 independent S. mutans cultures) in each group.

Only gold members can continue reading. Log In or Register to continue

Stay updated, free dental videos. Join our Telegram channel

Nov 22, 2017 | Posted by in Dental Materials | Comments Off on Mechanistic, genomic and proteomic study on the effects of BisGMA-derived biodegradation product on cariogenic bacteria

VIDEdental - Online dental courses

Get VIDEdental app for watching clinical videos