Abstract
The effects of mechanical instruments on the viability of cells are essential in terms of regeneration. There is considerable interest in cell repair following damage mediated by dental surgical procedures. Cells can tolerate stress by expressing heat shock protein 70 (Hsp70). During and after surgical tooth removal, oxidative stress can activate Hsp70 expression proportional to the intensity of the stress signal stimulus to cope with stress. This study examined the expression of Hsp70 as a potential biomarker of immediate postoperative stress in patients undergoing two different surgical procedures of different severity. Expression of Hsp70 both at mRNA and at protein level in the conventional group was two-fold higher than that of the piezo group. This suggests that tooth movement by the piezo method causes relatively lower stress in the alveolar bone. Piezosurgery provides relatively low stress to the patients and this may help cell repair after the surgical procedure. Patients undergoing more aggressive surgery using conventional methods showed a significant increase in Hsp70 in the immediate postoperative period. Therefore, Hsp70 induction can be a potential tool as a prognostic surgical marker.
Bone cutting with micro vibrations is a relatively new and novel technique for sectioning hard tissues without damaging adjacent tissues. Two different methods were compared by operation time and degree of stress by determining heat shock protein 70 (Hsp70) expression levels.
The Hsp super-family protects cells from stress such as heat, infections, fever, inflammation, toxins, ischaemia and oxidative stress. Hsps are proteins conserved during evolution. An organism possesses structurally related but functionally distinct Hsps in compartments such as the endoplasmic reticulum, mitochondria, and cytosol. Hsp70 is a highly studied protein in the super-family and is used as a stress marker. Hsp70 has a distinct analogue Hsc70. The cognate form (Hsc70) is constitutively expressed in a cell, but under stress the cell expresses Hsp70.
Hsp70 basically has two domains: ATPase and peptide binding domain. The peptide binding domain has a cavity and a lid on this cavity. The cavity forms a hydrophobic environment and allows substrate peptide to find its correctly folded state. Peptide strongly binds to Hsp70 in the ADP state and binds loosely in the ATP state. The ATPase domain hydrolyses ATP and the energy from hydrolysis coordinates opening and closing of the lid. Therefore, the inter-domain signal helps substrate protein to fold. Hsp70 processes seven residues of substrate protein at a time and Hsp70 cooperates and coordinates with several other proteins during this process. Hsp40 submits the substrate protein to Hsp70 through its conserved J domain. This interaction stimulates Hsp70 ATPase activity and the Hsp70–Hsp40 complex either folds the substrate or sends it for degradation. Some Hsp40 proteins show ATPase activity themselves and help substrate protein folding. There are several different types of Hsp40s present in the cell and experiments have shown that Hsp70 pairs with Hsp40 to perform specific functions. Details of these specific functions are elusive. Nucleotide exchange factors remove ADP from the ATPase domain of Hsp70, so that another substrate-protein folding cycle can start. When protein aggregates, another Hsp (Hsp100) chops off the aggregated proteins. Hsp100 has a unique structure and behaves like a rotating blade and dissolves a substrate protein from the aggregate. The substrate is processed by the Hsp70–Hsp40 complex. Details of the substrate protein dissolving mechanism and the different types of Hsps can be found in a recent review article.
During the surgical procedure, mechanical stress may cause oxidative stress at alveolar bone and its surrounding tissues. A stress response is produced during tooth removal and after the finalization of the operation. Hsp70 is induced to maintain homeostasis under stress conditions. The cytoprotective role of induced human Hsp70 (HSPA1A) has been documented in human diseases. Stress induced Hsp70 plays an essential role in the protection of stressed cells that produce oxygen free radicals. Stress dependent Hsp70 synthesis is proportional to the intensity of the stimulus so the extent of the expression provides a method for comparing the two surgical methods.
Materials and methods
20 patients with bilateral and symmetrical impacted mandibular third molar teeth underwent surgery. On one side, removal of the alveolar bone was performed with conventional burs and on the other side with piezosurgery. A month elapsed between each mandibular tooth removal operation since removal of the tooth at the same time may interfere with Hsp70 expression determination. A 3 mm × 5 mm piece of alveolar bone was removed from each patient and kept at −80 °C.
All the samples were obtained by the same oral surgeon from patients at Cumhuriyet University. The patients had no oral or systemic diseases at the time of the procedure. Breastfeeding mothers, smokers, and alcohol addicts were excluded from the study. All the patients were informed in advance and signed forms were obtained from them giving their consent to use the material for scientific purposes. The procedure was approved by the Internal Review Board for Human Research. Differences in the mean values of measured activities were evaluated statistically using the SPSS 16.0 program (Univariate Variance Analyses and Pearson Correlation). Probability values of p < 0.05 were considered to be significant.
Determining amount of Hsp70
The samples were treated with liquid nitrogen and ground to increase their surface area. A modified protocol was used to obtain proteins from the alveolar bone samples. 0.2 g bone/1 ml 1.2 M HCl was incubated overnight at 4 °C, centrifuged and kept (solution 1). The bone was treated with 6 M guanidium HCl, 100 ml Tris pH 7.4, 0.125 M ethylenediamine tetraacetic acid (EDTA) for 72 h at 4 °C, centrifuged and kept (solution 2). Solutions 1 and 2 were combined and precipitated with acetone. Four volumes of acetone at −20 °C were added to the samples, vortexed and incubated at −20 °C for 2 h. After 10 min centrifugation at 4 °C and 16,000 rpm, the supernatant was decanted. The precipitate was washed with water/acetone (1/4 ratio) mixture. The samples were dried. The amount of protein was measured with a commercial enzyme linked immunosorbent assay (ELISA) kit protocol (Assay Design, Ann Arbor, USA). The samples were measured by a plate reader (Biokinetic reader/EL312, Vermont, USA) at 450 nm wavelength.
Determining Hsp70 mRNA levels
The finely powdered bone tissue was treated with TriReagent to isolate the RNA. The RNA extract was separated from the bone by centrifugation and the RNA was isolated using a commercially available kit (Qiagen ATQ Biotechnology, Turkey). Using the extracted RNA as a template, cDNA was synthesized (Roche). Quantitative polymerase chain reaction (PCR) was conducted using HSP70 and housekeeping β-actin primers (HSP70 forward ATAAAAGCCCAGGGGCAAGC, HSP70 reverse CTGGAAACGGAACACTGGAT; β-actin forward 5′ GGAGAATGGCCCAGTCCTC 3′, β-actin reverse 5′ GGGCACGAAGGCTCATCAT 3′). PCR was carried out with 40 cycles (95 °C 10 s, 60 °C 10 s, 72 °C 8 s) and a 200 base pair segment of target cDNA was quantified by DNA dye SYBR Green I. All assays were performed in triplicate (Applied Biosystems 7500 Fast).
Results
The average age of the patients was 21.85 ± 3.08 years (range 19–32 years). There were 7 males and 13 females. 8 of the third molar teeth on the right side and 12 of the third molar teeth on the left side were operated on with conventional burs; the rest were operated on with piezosurgery. The individuals were grouped randomly.
The operation times for piezosurgery and conventional surgery were 1150.60 ± 306.59 s and 751.70 ± 167.03 s, respectively. The difference was significant statistically ( p = 0.001, p < 0.05).
Hsp70 synthesis levels by ELISA and by mRNA expression
The expression in piezosurgery (9.50 ± 1.39 ng/ml) was less than in the conventional method (14.24 ± 1.56 ng/ml). The operation time with the piezo method is one and a half times longer than the conventional method but the expressed Hsp70 concentration is one and a half times lower than that of the conventional method. The amount of expressed protein over time is 18.94 pg/(ml sn) and 8.26 pg/(ml sn) for the conventional and piezo methods, respectively. This means conventional surgery produces 2.29-fold higher Hsp70 in the alveolar bone cells ( p = 0.003, p < 0.05).
Expression of Hsp70 mRNA in the conventional group was approximately 1.60 times higher than that of the control group, consistent with the Hsp70 protein levels determined by ELISA ( Fig. 1 ). In the piezo group, mRNA expression was 3.40 times higher than that of the control ( p = 0.001, and p = 0.003 for each method compared to the control thus, p < 0.05 for both; a 2.10-fold difference between the different methods). Both experimental designs support inductive Hsp70 expression level differences between piezo and conventional methods.
