Abstract
Malignant melanoma of the oral mucosa is common in Japan. The effects on metastasis of puncturing the tumor before surgery or using chemotherapy after extirpation of the tumor were studied using animal models. G-361 cells were transplanted subcutaneously into mice. In half the animals, the subcutaneous tumor was punctured with an 18G needle twice a week from 2 weeks after transplantation until death. In the other mice, the subcutaneous tumor was extirpated 6 weeks after transplantation; the animals were killed 2 weeks later. Dimethyl triazeno imidazole carboxamide (DTIC) or cisplatin (CDDP) were injected into the peritoneal cavity 3 days before extirpation or during extirpation. Metastases to the axilla lymph node and the lung were examined in both groups. The animals that received puncturing developed lymph node and pulmonary metastasis earlier and more frequently than those without puncturing. 50% of mice that received no anticancer agent, had lymph node and pulmonary metastases after tumor extirpation. Preoperative DTIC or CDDP reduced the frequency of metastasis to 25–35%. DTIC or CDDP administration during extirpation, significantly reduced the metastasis rate to 7–10%. Prognosis for oral melanoma patients may be better when surgery and postoperative chemotherapy are performed simultaneously without preoperative surgical procedures.
The frequency of malignant melanoma of the oral cavity is relatively high among Japanese people in contrast to that in Caucasian populations . There are four main types of cutaneous melanoma: lentigo maligna melanoma (LMM), superficial spreading melanoma (SSM), nodular melanoma (NM), and acral lentiginous melanoma (ALM) . The classification and treatment of oral melanoma remains controversial. Most oral mucosal melanomas have radial growth phases similar to those of ALM of the skin . Some authors have advocated classifying oral melanoma separately from cutaneous melanoma because of the poor prognosis of oral melanoma patients.
Treatment for oral melanoma is surgery followed by immunochemotherapy, starting on the day of surgery, involving dimethyl triazeno imidazole carboxamide (DTIC), nimustine hydrochloride (ACNU), vincristine (VCR), and biological response modifier OK-432. The prognosis of 14 patients using this treatment was good . The 5-year survival rate of 12 patients who had undergone this therapy with no preoperative surgical procedure (such as biopsy, incision or tooth extraction) was 92%, while that of 9 patients who had undergone surgical procedures before treatment was 26%; the prognosis for patients with oral melanoma can be as good as that for patients with cutaneous melanoma if appropriate therapy is used .
The authors have reported an in vivo animal model for the metastasis of oral cancer . Human malignant tumors that have been grafted into the subcutaneous tissue of nude mice rarely invade or metastasize, but they can metastasize to regional lymph nodes and the lung when surgical procedures are repeated after transplantation . This study investigates the influence of surgical procedures on the metastasis of melanomas and the effect of chemotherapy on the prevention of metastasis after resection of a subcutaneous tumor using an in vivo animal model.
Materials and Methods
5-week-old female BALBnu/CrlCrj nude mice (Japan Charles River, Yokohama, Japan) were used for the experiments and kept under sterile conditions throughout. All animal experiments were performed in compliance with the Guidelines for Animal Experiments at Kobe University Graduate School of Medicine.
A human malignant melanoma cell line (G-361) was provided by JCR Bank. The cells were maintained in monolayer culture in EMEM (with Earle’s salt, NaHCO 3 , and L-glutamine) (SIGMA, USA) mixed with 10% fetal bovine serum (FBS), 10,000 units/ml penicillin, and 10 mg/ml streptomycin (penicillin–streptomycin). They were maintained at 37 °C in a humidified atmosphere of 5% CO 2 in air.
4.0 × 10 3 G-361 cells were transplanted subcutaneously into the backs of nude mice. After growing to 10 mm in diameter, the tumor was extirpated, cut into 1 mm 3 pieces, and transplanted into the subcutaneous tissue of the lateral back of the different nude mice.
G-361 tumor was transplanted in 200 mice. Half of the animals underwent puncturing of the subcutaneous tumor using an 18G needle twice a week from 2 weeks after transplantation to death. The animals were killed every week from 2 to 6 weeks after transplantation, and the axilla lymph node and the lung were extirpated. The specimens were investigated by polymerase chain reaction (PCR) analysis (described below) to detect micro-metastasis.
G-361 tumor was transplanted into 10 other mice and the grafted tumour was punctured in the same way. These mice were killed at 6 weeks, and the axilla lymph node and the lung were examined histologically by hematoxylin-eosin (HE) staining
Lymph node and lung metastasis was detected by PCR analysis of the human β-globin gene according to the methods reported by K omatsubara et al. and S higeta et al. .
Genomic DNA was extracted from them using SepaGene (Sanko Jun-Yaku, Tokyo, Japan) according to the protocol recommended by the manufacturer. Two sets of primers were designed for the human β-globin gene ( Table 1 ). The PCR conditions for the first reaction were 94 °C for 90 s for 1 cycle, then 30 cycles of denaturing at 94 °C for 30 s, annealing at 58 °C for 90 s, and extension at 70 °C for 45 s. The first primers were designed outside the amplified region using the nested primer. In the second step, the first PCR product was removed and reamplified using 2 sets of overlapping inner primers. The conditions for the nested PCR were the same as those for the first reaction. The PCR product was electrophoresed in a 2.0% agarose gel containing 0.5 μg/ml ethidium bromide.
| First | ||
| GH20 (forward) | GAAGAGCCAAGGACAGGTAC | 408 bp |
| GH21 (reverse) | GGAAAATAGACCAATAGGCAG | |
| Second | ||
| KM29 (forward) | GGTTGGCCAATCTACTCCCAGG | 262 bp |
| KM38 (reverse) | TGGTCTCCTTAAACCTGTCTTG | |
Once the transplanted tumor grew to 10 mm in diameter, 50 mg/kg of DTIC or 8 mg/kg of cisplatin (CDDP) were injected into the peritoneal cavity, and the tumour volume was measured every day after the administration of the anticancer agent. 10 animals (5 in each subgroup) were used for this experiment. The tumor volume was calculated as major axis × minor axis 2 × 1/2.
6 weeks after transplantation of the G-361 cells, the animals underwent extirpation of the subcutaneous tumor under general anesthesia. They were sorted into five subgroups: control group; preoperative DTIC group; preoperative CDDP group; simultaneous DTIC group; and simultaneous CDDP group ( Fig. 1 ). 150 mice (30 in each subgroup) were used; 3 mice died during the experiment. The animals were killed 8 weeks after transplantation, and the frequency of metastases to the axilla lymph node and the lungs were examined using the PCR method. Statistical analysis was performed using the X 2 test.
Results
2–4 weeks after transplantation of the G-361 cells, no metastatic tumor was detected in the axilla lymph node or the lungs. At 5 weeks, 1 of 10 mice (10%) showed a positive reaction in the lung, but no lymph node metastasis was detected. At 6 weeks, metastasis was detected in 5 of 10 (50%) lungs and 4 of 10 (40%) lymph nodes.
The animals that had undergone repeated puncturing showed positive PCR results earlier and more frequently than those that did not undergo any surgical procedures. Metastasis to the node at 3, 4, 5 and 6 weeks after transplantation was found in 1/10 (10%), 4/10 (40%), 4/10 (40%), and 6/10 (60%) mice, while that to the lung at 4, 5, and 6 weeks was found in 4/10 (40%), 3/10 (30%), and 8/10 (80%) mice ( Figs. 2, 3 ). Histological examination revealed metastasis to the node and lung 6 weeks after transplantation in 2/10 (20%) mice in each group ( Figs. 4, 5 ). These results indicate that G-361 cells metastasize spontaneously when transplanted into the subcutaneous tissue of nude mice and that surgical procedures promote metastasis to the regional lymph node and the lungs.
After DTIC or CDDP injection, the size of the transplanted G-361 tumor decreased, but the duration of the remission of the tumor was short, and re-growth of the tumor was observed within 4–5 days. There was no statistical difference between the effectiveness of DTIC or CDDP ( Fig. 6 ).
After extirpation of the subcutaneous G-361 tumor at 6 weeks, subsequent metastasis to the regional lymph node was detected in 15 of 30 mice (50%), while 16 of 30 mice (53%) showed metastasis to the lung. The administration of DTIC, 3 days before extirpation of the tumor, reduced the rate of lymph node and lung metastases to 10/29 (35%) and 9/29 (31%), respectively, although these were not significantly different from the control group values ( Fig. 7 ). The administration of DTIC during tumor extirpation significantly decreased the lymph node and pulmonary metastasis rate to 2/30 (7%) and 3/30 (10%), respectively.
The effect of CDDP on the metastasis observed after extirpation of the G-361 tumor was similar to that of DTIC. The subsequent lymph node and pulmonary metastasis rates when CDDP was injected 3 days before tumor extirpation were lower than those of the control group at 8/28 (29%) and 9/28 (32%), respectively, but the difference was not significant. When CDDP was administrated during tumor extirpation, the metastasis rates in the regional lymph nodes and the lungs were 2/30(7%) and 3/30 (10%), significantly lower than those of the control group. These findings suggest that DTIC and CDDP are effective at preventing secondary metastasis after the primary lesion has been resectioned, especially when they are administrated immediately after surgery.
Results
2–4 weeks after transplantation of the G-361 cells, no metastatic tumor was detected in the axilla lymph node or the lungs. At 5 weeks, 1 of 10 mice (10%) showed a positive reaction in the lung, but no lymph node metastasis was detected. At 6 weeks, metastasis was detected in 5 of 10 (50%) lungs and 4 of 10 (40%) lymph nodes.
The animals that had undergone repeated puncturing showed positive PCR results earlier and more frequently than those that did not undergo any surgical procedures. Metastasis to the node at 3, 4, 5 and 6 weeks after transplantation was found in 1/10 (10%), 4/10 (40%), 4/10 (40%), and 6/10 (60%) mice, while that to the lung at 4, 5, and 6 weeks was found in 4/10 (40%), 3/10 (30%), and 8/10 (80%) mice ( Figs. 2, 3 ). Histological examination revealed metastasis to the node and lung 6 weeks after transplantation in 2/10 (20%) mice in each group ( Figs. 4, 5 ). These results indicate that G-361 cells metastasize spontaneously when transplanted into the subcutaneous tissue of nude mice and that surgical procedures promote metastasis to the regional lymph node and the lungs.
