Abstract
This study investigated the effect of pore size on osteoblastic phenotype development in cultures grown on porous titanium (Ti). Porous Ti discs with three different pore sizes, 312 μm (Ti 312), 130 μm (Ti 130) and 62 μm (Ti 62) were fabricated using a powder metallurgy process. Osteoblastic cells obtained from human alveolar bone were cultured on porous Ti samples for periods of up to 14 days. Cell proliferation was affected by pore size at day 3 ( p = 0.0010), day 7 ( p = 0.0005) and day 10 ( p = 0.0090) in the following way: Ti 62 < Ti 130 < Ti 312. Gene expression of bone markers evaluated at 14 days was affected, RUNX2 ( p = 0.0153), ALP ( p = 0.0153), BSP ( p = 0.0156), COL ( p = 0.0156), and OPN ( p = 0.0156) by pore size as follows: Ti 312 < Ti 130 < Ti 62. Based on these results, the authors suggest that porous Ti surfaces with pore sizes near 62 μm, compared with those of 312 μm and 130 μm, yield the highest expression of osteoblast phenotype as indicated by the lower cell proliferation rate and higher gene expression of bone markers.
Over the past 40 years, titanium (Ti) has been considered the gold standard biomaterial for fabricating implants for dental and orthopaedic purposes. Classically, implant fixtures are prepared with bulk Ti, which varies in surface morphology, and despite the high rate of success, limitations such as interfacial instability with host tissues, and lack of biological anchorage have been reported. Methods of improving bone–implant fixation, mainly in critical bone sites, remain an absorbing topic in implantology. There is interest in porous biomaterials, which provide anchorage by favouring ingrowth of mineralized tissue into the pores.
The powder metallurgy process is able to produce Ti foams with adjustment of the pore size within the range required for bone ingrowth. In a previous study, the authors showed the development of an osteoblast phenotype of cells cultured on porous Ti produced by this method. The data revealed that the thickness of the porous Ti coating affects osteoblast phenotype expression. Several studies have suggested that porous biomaterials should present adequate interconnected pore size to allow the formation of a new vascular system for continuing bone ingrowth. Implants with a pore size range from 50 to 400 μm have been considered acceptable to allow biological anchorage. There is no consensus on the optimal pore size to yield the ideal tissue response. The present study was designed to evaluate the osteoblast phenotype expression of human alveolar bone-derived cells grown on porous Ti with three different pore sizes.
Materials and methods
Porous Ti foams were produced as described elsewhere. Ti powder was dry-mixed with a polyethylene binder and a chemical foaming agent (p,p′-oxybis[benzenesulfonyl hydrazide]). This mixture was poured into a mould and foamed at 210 °C in air. The resulting material was debinded at 450 °C in argon and presintered under vacuum at 1000 °C, with three different pore sizes, 312 μm (Ti 312) 130 μm (Ti 130), and 62 μm (Ti 62), and the same porosity of 60%. All samples were machined to obtain discs 12 mm in diameter and 2 mm thick. The discs were washed for 15 min in acetone in an ultrasonic bath (Bandelin Sonorex, Amtrex Technologies Inc., St. Laurent, Quebec, Canada). The porous specimens were sintered at 1400 °C to consolidate the material and autoclaved at 120 °C for 40 min before use in cell culture experiments.
Cell culture
Human alveolar bone fragments (explants) from two healthy male donors, aged 23 and 28 years, were used under the rules of the Committee of Ethics in Research (2007.1.94.58.5). Osteogenic cells were harvested from these explants by enzymatic digestion using type II collagenase (Gibco – Life Technologies, Grand Island, NY, USA) as described elsewhere. These cells were cultured in α-minimum essential medium (Gibco), supplemented with 10% foetal bovine serum (Gibco), 50 μg/ml gentamicin (Gibco), 0.3 μg/ml fungisone (Gibco), 10 −7 M dexamethasone (Sigma, St. Louis, MO, USA), 5 μg/ml ascorbic acid (Gibco), and 7 mM β-glycerophosphate (Sigma) until subconfluence. The first passaged cells were cultured in 24-well culture plates (Falcon, Franklin Lakes, NJ, USA) on porous Ti samples at a cell density of 2 × 10 4 cells/sample. Cultures were kept at 37 °C in a humidified atmosphere of 5% CO 2 and 95% air; the medium was changed every 3 or 4 days.
Fluorescence labelling
On day 3, the cells were fixed for 10 min at room temperature using 4% paraformaldehyde in 0.1 M phosphate buffer (PB), pH 7.2. Cells were permeabilized with 0.5% Triton X-100 in PB for 10 min followed by blocking with 5% skimmed milk in PB for 30 min. Primary antibody to human Ki-67 (polyclonal, 1:70; Diagnostic Biosystems, Pleasanton, CA, USA) was used, followed by Alexa Fluor 594 (red fluorescence) conjugated goat anti-rabbit secondary antibody (1:200; Molecular Probes, Invitrogen, Eugene, OR, USA). Alexa Fluor 488 (green fluorescence) conjugated phalloidin (1:200, Molecular Probes) was used to label actin cytoskeleton. All antibody incubations were performed in a humidified environment for 60 min at room temperature. Cell nuclei were stained with 300 nM 4′,6-diamidino-2-phenylindole, dihydrochloride (DAPI, Molecular Probes) for 5 min. Porous Ti samples were mounted face up on glass slides and a glass coverslip was mounted with an antifade kit (Vectashield, Vector Laboratories, Burlingame, CA, USA) on the surface containing cells.
The samples were examined by using a fluorescence microscope (Leica, Bensheim, Germany) fitted with a Leica DC 300F digital camera under epifluorescence. The digital images acquired were processed with Adobe Photoshop software.
Culture growth
Culture growth was evaluated on days 3, 7, and 10 by 3-[4,5-dimethylthiazol-2-yl]-2,5-diphenyl tetrazolium bromide (MTT) assay. Cells were incubated with 100 μl of MTT (5 mg/ml) in phosphate buffered saline (PBS) at 37 °C for 4 h and after that, 1 ml of acid isopropanol (0.04 N HCl in isopropanol) was added to each well. The plates were stirred for 5 min, and 100 μl of this solution was used to read the optical density at 570 nm on the plate reader (μQuant, Biotek, Winooski, VT, USA) and data were expressed as absorbance. To avoid any background, samples of porous Ti were kept in culture medium without cells and assayed to subtract the absorbance from experiments carried out with cells.
Real-time PCR
At 14 days, gene expression of runt-related transcription factor 2 ( RUNX2 ), alkaline phosphatase ( ALP ), bone sialoprotein ( BSP ), type I collagen ( COL ), and osteopontin ( OPN ) were evaluated by real-time reverse transcriptase-polymerase chain reaction (real-time PCR). Primers were designed with Primer Express 2.0 (Applied Biosystems, Foster City, CA, USA) and are shown in Table 1 .
| Gene | Sequence primer sense Sequence primer anti-sense |
TM (°C) | bp |
|---|---|---|---|
| RUNX2 | TATGGCACTTCGTCAGGATCC AATAGCGTGCTGCCATTCG |
83 | 110 |
| ALP | ACGTGGCTAAGAATGTCATC CTGGTAGGCGATGTCCTTA |
86 | 475 |
| BSP | AATCTGTGCCACTCACTGCCTT CCTCTATTTTGACTCTTCGATGCAA |
79 | 201 |
| COL | CCACAAAGAGTCTACATGTCTAGGGTC GTCATCGCACAACACCTTGC |
84 | 114 |
| OPN | AGACACATATGATGGCCGAGG GGCCTTGTATGCACCATTCAA |
79 | 154 |
| β-ACTIN | ATGTTTGAGACCTTCAACA CACGTCAGACTTCATGATGG |
75 | 495 |
Total RNA was extracted using the Promega RNA extraction kit (Promega, Madison, WI, USA), according to the manufacturer’s instructions. Complementary DNA (cDNA) was synthesized using 2 μg of RNA through a reverse transcription reaction (M–MLV reverse transcriptase, Promega). Real-time PCR was carried out in an ABI Prism 7000 Sequence Detection System using the SybrGreen system (Applied Biosystems, Warrington, UK). SybrGreen PCR MasterMix (Applied Biosystems), specific primers and 2.5 ng cDNA were used in each reaction. The standard PCR conditions were 95 °C (10 min) and 40 cycles of 94 °C (1 min), 56 °C (1 min) and 72 °C (2 min), followed by the standard denaturation curve. For mRNA analysis, the relative level of gene expression was calculated in reference to β-actin expression and normalized by the gene expression of cells cultured on polystyrene using the cycle threshold (Ct) method.
Statistical analysis
Quantitative data for cell culture experiments presented in this work are the representative results of two independent experiments using two sets of cultures established from two different donors. For each experiment, culture growth was carried out in quintuplicate ( n = 5) and gene expression, in triplicate ( n = 3). Analyses were undertaken using the Kruskal–Wallis test followed by the Fisher test based on rank, comparing all surfaces for each time point (level of significance 5%). The Benjamini–Hochberg multiple test correction was used to adjust all p values.
Results
Fluorescence labelling
Adherent cells were spread and distributed throughout the surfaces of all porous Ti as evidenced by actin cytoskeleton labelling on day 3 ( Fig. 1 A–C) . No relevant differences among the three pore sizes were noticed and the majority of cells on Ti samples presented a spread polygonal shape. The spherical features of porous surfaces affected cell morphology, as some cells edged the perimeter of the spheres. Immunolabelled preparations with an anti-Ki67 antibody revealed that at day 3 all surfaces presented a high proportion of cells in proliferative activity.
