The effects of nerve growth factor on endothelial cells seeded on different titanium surfaces

Abstract

Angiogenesis is critical for peri-implant bone regeneration and osseointegration. Endothelial cells (ECs) play an important role in angiogenesis during the early stage of bone formation. Nerve growth factor (NGF) is also reported to function as an angiogenic growth factor. The effects of NGF on ECs seeded on titanium surfaces are unclear. This study was done to investigate the influence of NGF on peri-implant angiogenesis in vitro and in vivo. We used two different titanium surfaces. ECs seeded on these surfaces were treated with indicated concentrations of NGF or vascular endothelial growth factor (VEGF). Proliferation, differentiation, morphological features, and amounts attached were assessed. Chicken embryo chorioallantoic membrane (CAM) was adopted to evaluate the effect of NGF in vivo. The results showed that NGF could promote EC proliferation on both titanium surfaces ( F 1d = 2.083, P = 0.156; F 3d = 30.857, P = 0.0002; F 5d = 4.440, P = 0.041; F 7d = 11.065, P = 0.001). NGF and the SLA surface upregulated mRNA of NGF, TrkA, and p75 expression ( F NGF = 11.941, P = 0.003; F TrkA = 28.514, P = 0.004; F p75 = 7.725, P = 0.01). In vivo, the supernatants of the NGF-treated group could promote neovascularization in CAM ( F = 17.662, P = 0.009). This study demonstrated that NGF could enhance EC proliferation, gene expression on different titanium surfaces, and neovascularization in CAM. This provides novel information in relation to the promotion of early dental implant osseointegration.

Dental implants are a reliable treatment for the replacement of missing teeth. Early stage peri-implant bone formation is an important factor for the success of dental implants. Angiogenesis is a critical process during the formation of new bone, bone regeneration, and osseointegration. Bone mineralization and ossification are tightly coupled with angiogenesis . The formation of blood vessels is one of the earliest events during bone repair.

Nerve growth factor (NGF), first investigated over 60 years ago, is known for its important role in the central and peripheral nervous system. NGF was the first discovered nerve growth-promoting factor. Evidence has shown that it has effects not only on neuronal cells but also on several non-neuronal cells. NGF functions by binding to its two receptors: one is the high-affinity receptor, tyrosine kinase receptor A (TrkA), and the other is the low-affinity receptor, neurotrophin receptor p75 (p75). The discovery of the TrkA and p75 receptors in non-neural tissues, including endothelial cells (ECs), indicates that the influence of NGF is not restricted to the nervous system.

ECs play a pivotal role in the osseointegration of dental implants. ECs have been regarded as an important initiator of the development, remodelling, and repair of bone for a long time. When bone is injured, there is always a hypoxic milieu around the fracture caused by the disruption of blood vessels (oxygen supply). Hypoxia can regulate the production of key modulators by osteoblasts that influence EC proliferation, and at the same time, induce the secretion of osteogenic growth factors by ECs.

The effects of NGF on ECs have been studied widely, but the responses of ECs on implant surfaces with different micro-topographies remain unknown. Hence, we chose two titanium surfaces for this study, the sandblasted with large-grits, acid-etched surface (SLA) and the polished titanium surface (PT). The SLA implant surface is the most widely used in clinics for its advantages in improving osseointegration. PT was the first clinically available dental implant surface (Brånemark), and is still used widely in animal experiments due to its low cost and simplicity of manufacture. The purpose of this study was to further investigate the function of NGF in peri-implant angiogenesis in vitro and in vivo.

Materials and methods

Reagents

Recombinant human beta-NGF and recombinant rat vascular endothelial growth factor (VEGF) were purchased from R&D Systems (Minneapolis, MN, USA). Foetal bovine serum (FBS), Dulbecco’s modified Eagle medium (DMEM), and trypsin were purchased from HyClone (Logan, UT, USA). Cell counting kits (CCK-8) were purchased from Dojindo (Mashiki-machi, Kumamoto, Japan).

Cell culture

A clonal cell line – human umbilical vein endothelial cells (HUVECs), a gift from Dr. Yao – was cultured in DMEM containing 10% FBS and 1% penicillin–streptomycin, and incubated at 37 °C with 5% CO 2 .

Proliferation assay

HUVECs were digested by 0.25% trypsin with ethylenediaminetetraacetic acid (EDTA) and re-suspended in DMEM containing no FBS. Cells were then seeded in 96-well plates at a density of 10 4 /well and incubated at 37 °C with 5% CO 2 . After 12 h, the medium was replaced with fresh DMEM containing 2% FBS with or without NGF at concentrations of 0, 1, 10, and 100 ng/ml. The viability of HUVECs was assessed with the CCK-8 assay on days 1, 3, 5, and 7. The optical density (OD) values were measured at 450 nm using a microplate reader (Varioskan Flash; Thermo Fisher Scientific, USA). After this first step, the group showing the best result was chosen to repeat the CCK-8 assay, comparing this with the VEGF (10 ng/ml) group as the positive control.

Cell cycle assay

After 2 days of culture in different concentrations of NGF, HUVECs were digested with trypsin. The collected cells were then washed with phosphate buffered saline (PBS), centrifuged twice at 2000 × g for 5 min, and fixed with 70% ice-cold alcohol at 4 °C overnight. Cells were then centrifuged, washed with PBS, and incubated in 100 μl RNase at 37 °C for 30 min. Then 300 μl propidium iodide was added and the cells were incubated for 30 min at 4 °C. The S-phase fraction of total cells (SPF) and the DNA proliferation index (PI) of each sample were analyzed and calculated using flow cytometry (Beckman Coulter, USA), according to the following formulae: SPF (%) = S/(G0/G1 + S + G2/M) × 100%; PI (%) = (S + G2/M)/(G0/G1 + S + G2/M) × 100%.

Titanium surfaces

The titanium discs (14 mm in diameter and 1.0 mm in thickness) used in this study were made of commercial pure titanium and supplied by Prof. Liu (National Engineering Research Centre of Biomaterials, Sichuan University, China). These titanium substrates have been examined and used in many other studies by our group. Briefly, for the smooth surfaces, the discs were polished with a sequence of silicon carbide papers. To fabricate the SLA surfaces, the discs were blasted with 300-μm alumina oxide particles and were then ultrasonically cleaned and dried. The blasted samples were next subjected to double chemical etching with hydrogen peroxide and hydrochloric acid. Before the in vitro tests, all titanium discs were ultrasonically cleaned and sterilized in an autoclave. The roughness of the smooth surface was 2.59 Rz; the roughness of the SLA surface was 11.9 Rz.

The HUVECs seeded on these two surfaces were divided into four groups: (1) NGF + SLA group, in which cells were seeded on the SLA surface and treated with NGF; (2) SLA group, in which cells were seeded on the SLA surface, but not treated with NGF; (3) NGF + PT group, in which cells were seeded on the PT surface and treated with NGF; (4) PT group, in which cells were seeded on the PT surface, but not treated with NGF.

Cell proliferation on different titanium surfaces

The titanium discs were placed into 24-well plates (Costra, Coning). HUVECs were seeded at a density of 5 × 10 4 /well and treated with 10 ng/ml of NGF. Cell proliferation on the titanium surfaces was evaluated by MTT assay on days 1, 3, 5, and 7. The test was repeated with VEGF (10 ng/ml) as positive control; cell proliferation was evaluated by CCK-8 on day 3.

Cell attachment on different titanium surfaces

The titanium discs were placed into 24-well plates (Costra, Coning) and seeded with HUVECs at a density of 10 4 /well. After 4 h and 24 h, 4′,6-diamidino-2-phenylindole (DAPI) staining was performed to evaluate the amounts of attached cells under a fluorescent microscope (five visual fields for each sample); a scanning electron microscope (SEM) was used to evaluate the morphological features of HUVECs on the titanium substrates. Briefly, we fixed the cells with 2.5% glutaraldehyde for 2 h and dehydrated the samples with an ascending series of ethanol. The samples, treated by dehydration and coated with gold alloy, were then viewed under the SEM.

Real-time polymerase chain reaction (PCR)

HUVECs on titanium were collected with trypsin/EDTA solution at 37 °C and 5% CO 2 for 5 to 10 min. Total RNA was extracted with an RNA extraction kit (Bioer Technology, China) following the manufacturer’s instructions. The total RNA was quantified by spectrophotometer at A260 nm, and an A260/A280 between 1.8 and 2.0 was considered high purity. The total RNA was then reverse-transcribed to cDNA using a PrimeScript RT-PCR kit (Takara, Japan) following the manufacturer’s protocol. Each real-time PCR was carried out in triplicate and performed using an ABI PRISM 7300 Real-time PCR System (Applied Biosystems, USA). Human glyceraldehyde-3-phosphate dehydrogenase (hGAPDH) was used as internal control. The primers used for the real-time PCR are presented in Table 1 .

Table 1
qRT-PCR primers used in this study.
Target gene Primers Sequence
NGF Forward 5′ ACAGGAGCAAGCGGTCATCA 3′
Reverse 5′ ATGTCTGTGGCGGTGGTCTTA 3′
TrkA Forward 5′ TGGAGAAGAAGGACGAAACACC 3′
Reverse 5′ GCGGTTGATCCCAAACTTGTT 3′
p75 Forward 5′ CAAGACCTCATAGCCAGCACG 3′
Reverse 5′ GCCAGGATGGAGCAATAGACA 3′
VEGF Forward 5′ GAGGGCAGAATCATCACGAAGT 3′
Reverse 5′ GGCACACAGGATGGCTTGAA 3′

qRT-PCR, quantitative reverse transcriptase polymerase chain reaction; NGF, nerve growth factor; TrkA, tyrosine kinase receptor A; p75, neurotrophin receptor (TNFR superfamily, member 16); VEGF, vascular endothelial growth factor.

Chicken embryo chorioallantoic membrane (CAM) assay

Fertilized eggs were incubated at 37 °C with 60% humidity. On the 8th day, a square window was opened. CAMs were treated with 0.5 ml cell supernatant of each group. The embryos were then incubated at 37 °C with 60% humidity for another 24 h. The CAMs were then fixed in 4% paraformaldehyde for 1 h. Following this the CAMs were removed with curved-tip forceps and each specimen transferred to a Petri dish. Images were acquired with a computer scanner and analyzed with Image Pro Plus (Media Cybernetics, Silver Spring, MD, USA).

Statistical analysis

Data are presented as the mean ± standard deviation (SD). Statistical comparisons between groups were performed using one-way analysis of variance and the least significant difference (LSD) for multiple comparisons.

Results

Different concentrations of NGF induce the proliferation of ECs

To determine the best concentration, we initially examined the effects of different concentrations of NGF on EC proliferation using the CCK-8 and cell cycle assays. As shown in Table 2 , on day 3, 10 ng/ml NGF could significantly induce proliferation of ECs ( F = 5.849, P = 0.108), and this was very stable until day 7 ( F = 4.136, P = 0.025). The cell cycle assay showed that the 10 ng/ml group SPF and PI indexes were higher than those of the other groups ( F SPF = 14.145, P = 0.001; F PI = 161.332, P < 0.001; Table 3 ). Thus we chose the concentration 10 ng/ml for the subsequent experiments.

Table 2
HUVEC proliferation at different concentrations of NGF.
Day Concentration of NGF Mean SD 95% CI P -value a
Lower bound Upper bound
1 0 ng/ml 0.504 0.053 0.438 0.570 0.775
1 ng/ml 0.530 0.082 0.428 0.631
10 ng/ml 0.500 0.043 0.446 0.554
100 ng/ml 0.495 0.039 0.447 0.543
3 0 ng/ml 1.411 0.146 1.178 1.643 0.108
1 ng/ml 1.556 0.122 1.362 1.749
10 ng/ml 1.689 0.186 1.394 1.986
100 ng/ml 1.502 0.126 1.301 1.702
5 0 ng/ml 2.832 0.824 1.809 3.856 0.602
1 ng/ml 3.335 0.178 3.052 3.618
10 ng/ml 3.119 0.055 2.623 3.615
100 ng/ml 3.230 0.088 2.435 4.024
7 0 ng/ml 3.104 0.149 2.919 3.288 0.025
1 ng/ml 3.174 0.542 2.501 3.846
10 ng/ml 3.595 0.118 3.449 3.742
100 ng/ml 3.644 0.072 3.531 3.759
HUVEC, human umbilical vein endothelial cell; NGF, nerve growth factor; SD, standard deviation; CI, confidence interval.

a Analysis of variance.

Table 3
Cell cycle analysis of HUVECs at different concentrations of NGF.
Group Concentration of NGF Mean SD 95% CI P -value a
Lower bound Upper bound
SPF 0 ng/ml 0.344 0.005 0.333 0.356 0.001
1 ng/ml 0.370 0.016 0.332 0.409
10 ng/ml 0.375 0.004 0.364 0.386
100 ng/ml 0.338 0.002 0.333 0.343
PI 0 ng/ml 0.397 0.004 0.387 0.407 <0.001
1 ng/ml 0.435 0.005 0.423 0.446
10 ng/ml 0.427 0.003 0.418 0.435
100 ng/ml 0.359 0.006 0.344 0.375
HUVECs, human umbilical vein endothelial cells; NGF, nerve growth factor; SD, standard deviation; CI, confidence interval; SPF, S-phase fraction cell ratio; PI, proliferation index.

a Analysis of variance.

Cell proliferation on titanium

As shown in Table 4 , NGF could promote EC proliferation on both the SLA and PT titanium surfaces from day 3 ( F 1d = 2.083, P = 0.156; F 3d = 30.857, P = 0.0002; F 5d = 4.440, P = 0.041; F 7d = 11.065, P = 0.001). Moreover, the different titanium surfaces had a further effect. The MTT results for the PT + NGF group were significantly higher than for the SLA + NGF group at day 7 ( t = 2.855, P = 0.046). Figure 1 shows the morphological features of HUVECs on the titanium substrates. At 2 h, HUVECs were ball-shaped on both SLA and PT titanium; at 24 h, most HUVECs on PT titanium were stretched with a few exceptions, but on SLA titanium, all of the cells were stretched and fused into the rough titanium background.

Table 4
Cell proliferation on different titanium surfaces.
Day Group a Mean SD 95% CI P -value b
Lower bound Upper bound
1 NGF + SLA 0.494 0.025 0.455 0.533 0.156
SLA 0.439 0.009 0.424 0.453
NGF + PT 0.558 0.060 0.463 0.652
PT 0.509 0.119 0.320 0.699
3 NGF + SLA 1.236 0.034 0.931 1.541 0.0002
SLA 1.134 0.013 1.013 1.254
NGF + PT 1.164 0.096 0.926 1.402
PT 0.851 0.022 0.816 0.886
5 NGF + SLA 2.678 0.186 2.217 3.139 0.041
SLA 2.399 0.151 2.158 2.639
NGF + PT 2.732 0.025 2.670 2.795
PT 2.552 0.021 2.361 2.743
7 NGF + SLA 2.759 0.103 2.595 2.923 0.001
SLA 2.452 0.083 2.320 2.583
NGF + PT 3.089 0.264 2.668 3.510
PT 2.568 0.158 2.317 2.819
SD, standard deviation; CI, confidence interval; NGF, nerve growth factor; SLA, sandblasted with large-grits, acid-etched surface; PT, polished titanium surface.

a NGF + SLA: cells were seeded on an SLA surface and treated with NGF; SLA: cells were seeded on an SLA surface, but not treated with NGF; NGF + PT: cells were seeded on a PT surface and treated with NGF; PT: cells were seeded on a PT surface, but not treated with NGF.

b Analysis of variance.

Fig. 1
Cell morphological features on different titanium surfaces. (A) 2 h, NGF + SLA group; (B) 2 h, SLA group; (C) 2 h, NGF + PT group; (D) 2 h, PT group; (E) 24 h, NGF + SLA group; (F) 24 h, SLA group; (G) 24 h, NGF + PT group; (H) 24 h, PT group. As shown in parts A–D, at 2 h, HUVECs were ball-shaped on both SLA and PT titanium; the cells on SLA surfaces (A, B) were more stretched than those on PT surfaces (C, D). In parts E–H, at 24 h, most HUVECs on PT titanium (G, H) were stretched, with a few exceptions in the PT group (H), while on SLA titanium (E, F), all of the cells were stretched and fused into the rough titanium background.

The amounts of HUVECs on the different titanium surfaces are shown in Table 5 . At 24 h, the amounts of cells in the NGF groups (NGF + SLA and NGF + PT) were significantly higher than in the control groups (SLA and PT) ( F = 28.343, P < 0.001). Further, the amount of cells in the NGF + PT group was significantly higher than in the NGF + SLA group ( t = 8.536, P < 0.001).

Table 5
Amount of HUVECs attached to titanium.
Time Group a Mean SD 95% CI P -value b
Lower bound Upper bound
4 h NGF + SLA 127.250 48.717 86.522 167.979 0.809
SLA 117.250 42.253 81.925 152.575
NGF + PT 140.000 19.630 108.764 171.236
PT 117.333 43.122 72.080 162.587
24 h NGF + SLA 370.500 24.266 350.213 390.787 <0.001
SLA 278.000 60.584 214.421 341.579
NGF + PT 485.000 15.011 461.114 508.886
PT 304.000 20.785 270.927 337.073
HUVECs, human umbilical vein endothelial cells; SD, standard deviation; CI, confidence interval; NGF, nerve growth factor; SLA, sandblasted with large-grits, acid-etched surface; PT, polished titanium surface.

a NGF + SLA: cells were seeded on an SLA surface and treated with NGF; SLA: cells were seeded on an SLA surface, but not treated with NGF; NGF + PT: cells were seeded on a PT surface and treated with NGF; PT: cells were seeded on a PT surface, but not treated with NGF.

b Analysis of variance.

EC differentiation

As determined by real-time quantitative PCR, exogenous NGF and the SLA titanium surface could upregulate the expression levels of NGF and its receptors TrkA and p75 ( F NGF = 11.941, P = 0.003; F TrkA = 28.514, P = 0.004; F p75 = 7.725, P = 0.01). The levels of these three mRNAs in the NGF + SLA group increased to almost two-fold those of the SLA group ( Table 6 ).

Table 6
The differentiation of HUVECs measured by PCR.
mRNA Group a Mean SD 95% CI P -value b
Lower bound Upper bound
NGF NGF + SLA 2.147 0.411 1.125 3.169 0.003
SLA 1.206 0.236 0.619 1.794
NGF + PT 1.236 0.192 0.758 1.714
PT 1.000 0.000 1.000 1.000
p75 NGF + SLA 1.688 0.119 1.394 1.983 0.01
SLA 1.001 0.365 0.096 1.907
NGF + PT 1.194 0.130 0.872 1.517
PT 1.000 0.000 1.000 1.000
TrkA NGF + SLA 1.558 0.000 1.558 1.558 0.004
SLA 0.740 0.126 0.493 0.987
NGF + PT 1.296 0.139 0.043 2.549
PT 1.000 0.000 1.000 1.000
Only gold members can continue reading. Log In or Register to continue

Jan 17, 2018 | Posted by in Oral and Maxillofacial Surgery | Comments Off on The effects of nerve growth factor on endothelial cells seeded on different titanium surfaces
Premium Wordpress Themes by UFO Themes