Possible alternative treatment for mandibular asymmetry by local unilateral IGF-1 injection into the mandibular condylar cavity: Experimental study in mice

Introduction

The purpose of this study was to investigate whether a local unilateral IGF-1 injection into the mandibular condylar cavity can induce unilateral endochondral mandibular growth without any systemic adverse effects.

Methods

Seventy-five 3-week-old male Jcl:ICR mice were used in this study. The mice were divided into 2 groups: control group (n = 22) and IGF-1 group (n = 53). In the IGF-1 group, human IGF-1 was injected into the right mandibular condylar cavity, and phosphate-buffered saline solution was injected into the left cavity, 3 times per week for 10 weeks.

Results

There was no significant difference in body weight, serum human IGF-1 concentration, and soft tissue thickness of the cheeks including the masseter muscles between the 2 groups. Unilateral IGF-1 injection induced a lateral shift of the mandible to the contralateral side, and microcomputed tomogtraphy analysis showed that unilateral IGF-1 injection induced endochondral growth in the condyle. Col2, Ihh, and Runx2 were extensively upregulated by the local unilateral IGF-1 injection in real-time reverse transcription polymerase chain reaction analysis. Proliferation marker KI67, IGF-1 signaling molecule AKT1, and chondrogenic differentiation marker Col2 were strongly expressed in the IGF-1 injected condyle by immunohistochemistry. Vital labeling showed that the distance between the labels was increased in the IGF-1 injection group compared with that of the control group.

Conclusions

The results verified in this study indicated that local unilateral IGF-1 injection into the mandibular condylar cavity successfully induced unilateral endochondral mandibular growth in mice without any systemic adverse effects. Thus, local unilateral IGF-1 injection into the mandibular condylar cavity could be a useful alternative for mandibular asymmetry therapy during the growth period. However, additional experimental and clinical studies will be necessary to prove the real effect of this new therapy.

Highlights

  • •

    IGF-1 was injected unilaterally into the mandibular condylar cavity in mice.

  • •

    Local IGF-1 injection induced a lateral shift of the mandible.

  • •

    Local injection into the condylar cavity induced endochondral growth and ossification.

  • •

    Chondrogenic and osteoblastic gene expression was upregulated.

  • •

    No systemic effects were found.

It is well known that symmetry of the maxillofacial bone is essential for ideal occlusion. Letzer and Kronman reported that a comparative study of frontal cephalograms between ideal occlusion and malocclusion demonstrated a positive relationship between maxillofacial symmetry and ideal occlusion. Therefore, skeletal asymmetry, especially mandibular asymmetry, would result in malocclusion.

Factors for mandibular asymmetry are divided into congenital and acquired factors. Of them, acquired factors for mandibular asymmetry are categorized into 2 types: functional mandibular deviation and difference in the amounts of condylar growth between the sides. Functional mandibular deviation often transforms into skeletal mandibular asymmetry during growth. Several studies on artificial lateral displacement of the mandible reported increases in the articular condyle and mandibular growth on the contralateral side using various experimental models. Therefore, functional lateral displacement of the mandible during growth should be corrected as early as possible to promote favorable balanced growth and development of the mandible for obtaining facial symmetry. Another acquired factor is the disproportionate development of the mandible by different endochondral ossifications in both sides.

Various growth factors such as GH , FGF , BMP , and IGF-1 have been implicated in endochondral ossification. In particular, IGF-1 has been reported to be involved in growth by regulating endochondral ossification. IGF-1 regulates growth not only in limb bones, but also in the mandible. Iikubo et al developed a rat model of acromegaly by continuous subcutaneous infusion of human recombinant IGF-1 using implanted osmotic minipumps, and the rats hadd mandibular enlargement. In addition, Maor et al reported an in-vitro stimulative effect of IGF-1 on mouse primary condylar chondrocyte growth. A receptor for IGF-1, IGF-1R in rat condylar cartilage was also reported. An artificial mandibular functional shift resulted in the increase in the gene expressions of both IGF-1 and IGF-1R in the condylar cartilage of the contralateral side, and increased the mandibular condylar growth on the contralateral side. Furthermore, Itoh et al reported that the local injection of IGF-1 into the bilateral mandibular condylar cavities caused increased endochondral bone formation in the mandibular condyle, and the phenomenon was age-dependent in rats. Accordingly, these studies suggest a therapeutic effect of the local injection of growth factor on the condylar growth of the patient.

However, to the best of our knowledge, no study has investigated the possibility of correction of mandibular asymmetry via unilateral mandibular growth control with local unilateral IGF-1 injection. Therefore, we investigated in a mouse model whether the local unilateral injection of IGF-1 into the mandibular condylar cavity can induce unilateral endochondral mandibular growth at that side without systemic adverse effects.

Material and methods

The experimental protocol in animals was approved by the institutional animal care and use committee of Tsurumi University, Yokohama, Japan (approval numbers. 25P054, 26P041, 27P001, and 28P028), and carried out in accordance with the guidelines for animal experimentation of the university.

Seventy-five male Jcl:ICR mice, 3 weeks old (CLEA Japan, Tokyo, Japan), were used in this study. The mice were housed under specific pathogen-free conditions and fed powdered chow and tap water ad libitum. They were divided into the following 2 groups: control group (n = 22) and IGF-1 group (n = 53). In the IGF-1 group, the mice received a 20-μl (20 μg/site) intra-articular injection (see procedure of local IGF-1 injection below) of human IGF-1 solution (Somazon; Astellas Pharma, Tokyo, Japan) into the right mandibular condylar cavity, and 20 μL of phosphate-buffereed saline solution (PBS) into the left side.

Local injection of IGF-1 into the mandibular condylar cavity was performed by the method described by Kameoka et al under anesthesia with the intraperitoneal injection of medetomidine 0.3 mg per kilogram of body weight, midazolam 4.0 mg per kilogram of body weight, and butorphanol 0.5 mg per kilogram of body weight. Successful local injection into the mandibular condylar cavity was confirmed by hematoxylin dye injection using 11 mice. In the control group, 20 μL of intra-articular injections of saline solution were given on both sides 3 times per week for 10 weeks. The mice were killed by cervical dislocation at 10 weeks after the first injection. The soft tissues of their heads were scanned by x-ray microcomputed tomography (microCT) (MFZ; Hitachi, Tokyo, Japan). After the taking of these images of soft tissues, the mandibular condyles were excised out and rapidly immersed in liquid nitrogen. The frozen tissues were then embedded in precooled optimal cutting temperature compound (Sakura Finetek, Torrance, Calif) and soaked in liquid nitrogen until the optimal cutting temperature compound was completely frozen. The frozen mandibular specimens in the optimal cutting temperature compound were scanned by microCT, and the images were reconstituted using cone-beam CT express software (TRI/3D Bone; RATOC, Tokyo, Japan). After reconstitution and obtaining the DICOM files, 3-dimensional volume rendering was performed using OsiriX 64 bit (Pixmeo, Bernex, Switzerland). The lengths of the mandibles were measured in millimeters from the mesial contour of the mandibular first molar to the midpoint of the mandibular condyle ( Fig 1 , A-C ), and these were measured using multiplane reformation view in OsiriX 64 bit.

Fig 1
MicroCT analysis: the length from the mandibular first molar to the mandibular condyle was measured. Reference points for the measurement of mandibular length. A, Representative images of x-y plane; B, y-z plane; and C, x-z plane are shown. Measurement of soft tissue thickness at the cheek: microCT analysis of the thickness from the sagittal plane to the soft tissues. D, Representative images of y-z plane; E, s-y plane; and F, x-z plane are shown. Cd, Condylion; M1, first molar; AG, antegonion; St1, St2, surface of the soft tissue.

The soft tissues thicknesses (in millimeters) of the cheeks including the masseter muscles were also measured. Briefly, the intersection points of the line through the bilateral antegonions on the soft tissue surface were defined, and the length between the soft tissure surface and antegonion was measured as the soft tissue ( Fig 1 , D-F ).

All measurements were analyzed by 1 investigator (S.F.) at 3 times, and the same analysis was repeated on another day (with a 2-month interval). and measurement errors were examined. The measurement errors were 0.036 and 0.031 mm for mandibular length and soft tissue thickness, respectively.

Serial undecalcified frozen sections (7 μm thick) were prepared from the frozen mandibular specimens. The sections were fixed with 100% ethanol for 1 minute. The specimens for real-time reverse transcription polymerase chain reaction (RT-PCR) were obtained from the sections by laser capture microdissection using the PALM. MicroBeam system (P.A.L.M. Microlaser Technologies, Bernried, Germany) ( Fig 2 ).

Fig 2
Laser capture microdissection of the condylar cartilage in the frozen section. Whole layers of mandibular condylar cartilage that surrounded the solid line were excised. Bar: 50 μm.

RNA was extracted from the microdissected specimen tissues using the RNeasy Micro Kit (Qiagen, Hilden, Germany), according to the manufacturer’s instructions. Isolated RNA was reverse transcribed with iScript Reverse transcription supermix (Bio-Rad Laboratories, Hercules, Calif). Real-time RT-PCR analysis was performed with SsoFast EvaGreen Supermix (Bio-Rad Laboratories) using the primers described in the Table . Fold changes of genes of interest with the normalization by glyceraldehyde-3-phosphate dehydrogenase were calculated with ΔΔ cycle threshold method.

Table
Primer sequences used in this study
Gene Accession number Direction Primer sequence (5′ to 3′)
Col2 NM_031163 Forward
Reverse
GATGACATTATCTGTGAAG
ATCTCTGATATCTCCAGG
Ihh NM_010544 Forward
Reverse
CCTTCATCTTGGTGTAGAGC
GTCCAAAGACAGATGGAATG
Runx2 NM_009820 Forward
Reverse
GACCTCCAGGAAACCTTTGACAT
GGGCTGGATCTCAAACTCACA
Gapdh NM_008085 Forward
Reverse
ACTTTGTCAAGCTCATTTCC
GTGAGGGGAGGAGTCTCAA

IGF-1 levels in the serum at 24 hours after local human IGF-1 injection were measured using human IGF-1 ELISA kits (Enzo; Life Sciences, New York, NY) according to the manufacturer’s instructions.

For hematoxylin and eosin histomorphometry, the section was fixed with 4% paraformaldehyde and stained with hematoxylin and eosin dyes. The upper portion of the condylar head was divided into 3 areas: anterior, superior, and posterior. Condylar length, condylar cartilage thickness, and subchondral bone length at each area were measured.

For the bone apposition labeling study, 3 mice in the IGF-1 group were used. Briefly, calcein was injected intraperitoneally in the 10-week-old mice (16 mg/kg of body weight), followed by xylenol orange injection (50 mg/kg of body weight) at age 11 weeks. They were killed a week after the xylenol orange injection, and the mandibular condyles were excised out, and the serial undecalcified frozen sections were prepared. The upper portion of the condylar head was divided into 3 areas: anterior, superior, and posterior. The distance was measured from the calcein (green fluorescence) to the xylenol orange (red fluorescence) in each area.

For the immunohistochemistry, the sections were incubated for 30 minutes in 3% hydrogen peroxide to quench the endogenous peroxidase activity and then blocked with horse serum for 60 minutes at room temperature. The sections were incubated with the primary antibodies overnight at 4°C, followed by secondary antibodies (ImmPRESS REAGENT Anti-Rabbit Ig; Vector Laboratories, Burlingame, Calif). The primary antibodies were anti Ki67 antibody (1:250 dilution; Santa Cruz Biotechnology, Santa Cruz, Calif), anti Akt-1 antibody (1:200 dilution; Abcam Biochemicals, Cambridge, United Kingdom), and anti type2 collagen (Col2) antibody (1:200 dilution; Rockland Immunochemicals, Gilbertsville, Pa). Immunoreactivity was then visualized using diaminobenzidine and observed with a microscope (BZ-9000; Keyence, Osaka, Japan).

Statistical analysis

All data are given as means and standard deviations. The Student t test was used for evaluating statistical significance after testing for normality (version 11.0J; SPSS, Chicago, Ill). P <0.05 was considered statistically significant.

Results

No significant differences in body weight were observed between the IGF-1 and control groups during the experimental period ( Fig 3 , A ). There was no significant difference in serum human IGF-1 concentration between the IGF-1 and control groups ( Fig 3 , B ). MicroCT analysis of the soft tissue thicknesses of the cheeks showed no significant differences between the 2 groups ( Fig 3 , C ). These results suggest that local unilateral IGF-1 injection into the mandibular condylar cavity had no systemic effects.

Fig 3
No systemic effect of local unilateral IGF-1 injection was observed: A, body weights of the control group ( closed circle , n = 14) and the IGF-1 group ( open triangle , n = 35); B, serum IGF-1 ( NS , no significant difference between the groups [control, n = 5; IGF-1, n = 5]); C, soft tissue thicknesses at the cheeks are shown ( NS , no significant difference between the groups [control, n = 8; IGF-1, n = 18]).

Facial symmetry of the mice was assessed at the end of the experiment. Control mice exhibited symmetric mandibular growth with coordination of the upper and lower dental midlines ( Fig 4 , A ). On the other hand, in the IGF-1 group, the mandibular midline was deviated to the contralateral side of the IGF-1 injection side ( Fig 4 , B ).

Fig 4
Local unilateral IGF-1 injection induced unilateral growth of the mandible and consequently caused facial asymmetry. Representative facial photographs of A, the control group and B, the IGF-1 group are shown. Representative microCT images of C, the mandible of the PBS injection side and D, the IGF-1 injection side are shown. Cd , Center of mandibular condyle; M1 , Mesial contour of the mandibular first molar; E, the distance from M1 to Cd is shown. PBS , PBS injection side (n = 14); IGF , IGF-1 injection side (n = 35); NS , no significant difference between the sides. * P <0.05 between groups.
Only gold members can continue reading. Log In or Register to continue

Stay updated, free dental videos. Join our Telegram channel

Dec 12, 2018 | Posted by in Orthodontics | Comments Off on Possible alternative treatment for mandibular asymmetry by local unilateral IGF-1 injection into the mandibular condylar cavity: Experimental study in mice

VIDEdental - Online dental courses

Get VIDEdental app for watching clinical videos