Abstract
The phosphoinositide 3-kinase (PIK3)/v-akt murine thymoma (AKT) oncogene pathway and the RAS/RAF pathway are involved in regulating the signalling of multiple biological processes, including apoptosis, metabolism, cell proliferation, and cell growth. Mutations in the genes within these pathways are frequently found in several tumours. The aim of this study was to investigate the frequency of mutations in the PIK3CA , BRAF , and KRAS genes in cases of malignant salivary gland tumours. Mutational analysis of the PIK3CA , KRAS , and BRAF genes was performed by direct sequencing of material from 21 patients with malignant salivary gland tumours who underwent surgery between 1992 and 2001. No mutations were found in the KRAS exon 2, BRAF exon 15, or PIK3CA exon 9 genes. However, an unpublished mutation of the PIK3CA gene in exon 20 (W1051 stop mutation) was found in one case of adenocarcinoma NOS. The impact of this mutation on the biological behaviour of the tumour has yet to be explored, however the patient with adenocarcinoma NOS harbouring this mutation has survived for over 20 years following surgery despite a high stage at presentation. Further studies with more homogeneous patient cohorts are needed to address whether this mutation reflects a different clinical presentation and may benefit from targeted treatment strategies.
Malignant salivary gland tumours are an uncommon heterogeneous group of tumours with about 24 different subtypes. Most tumours are slow-growing and they are sometimes diagnosed at an advanced stage. Treatment mainly includes surgical resection, sometimes accompanied by radiotherapy.
Recent molecular genetic studies have shed some light on the genetic events associated with these uncommon tumours. For example the translocation t(11;19)(q21;p13) in mucoepidermoid carcinoma has been shown to predict a favourable outcome, and the translocation t(6;9)(q22-23;p23-24) in adenoid cystic carcinoma points towards a worse prognosis. Tyrosine kinases, which are the subject of targeted therapy, have been investigated recently, including the overexpression and amplification of the epidermal growth factor receptor family, for example HER2 in salivary duct carcinomas, and C-Kit in adenoid cystic carcinoma. In a recent study, new hotspot activating PRKD1 somatic mutations were found in the majority of polymorphous low-grade adenocarcinomas; these could be exploited to aid diagnosis and to serve as therapeutic targets. Expanding our knowledge of genetic mutations in the various signalling pathways could offer new insights into clinical outcomes and lead to possible targeted therapies.
The Ras/Raf/MEK/ERK and Ras/PIK3/PTEN/Akt/mTOR pathways are highly conserved pathways necessary for normal cell function, including cell growth, cell proliferation, and cell differentiation, via the transmission of proliferative signals from the cell membrane-bound receptors. These pathways are commonly deregulated in human cancer as a result of genetic mutations, making the components of these signalling cascades rational targets for therapeutic interventions.
The genetic profile of RAS/RAF and PIK3/AKT (phosphoinositide 3-kinase/v-akt murine thymoma) in malignant salivary gland tumours has been investigated in only a few studies. In the most recent of these, seven cases of salivary duct carcinoma (7/34, 20.5%) were shown to have three different PIK3CA mutations affecting exon 9 or exon 20. In another recently published study, 18 of 107 (16.8%) salivary gland tumours had at least one genetic alteration that was exclusive for KRAS , BRAF , HRAS , NRAS , and PIK3 .
The aim of this study was to investigate the mutational profile of PIK3CA , KRAS , and BRAF genes in a subset of malignant salivary gland tumours. The results will be correlated with the histological subtype and biological behaviour of the tumour.
Materials and methods
Study population
The archives of the Institute of Pathology of Chaim Sheba Medical Center were searched for malignant salivary gland tumours from patients treated over a 10-year period, between 1992 and 2001. The study protocol was approved by the institutional review board and by the Ministry of Health ethics review board for the use of genetic material. The anonymity of the patients investigated was preserved in accordance with the data protection rules of the Ministry of Health for the use of genetic material.
Formalin-fixed paraffin-embedded biopsy material was used for the study. Sections 5 μm in thickness were cut from the most representative block, stained with haematoxylin and eosin (H&E), and examined to confirm the diagnosis. Only cases with confirmed primary malignant salivary gland tumours, with the histopathological diagnosis in accordance with the World Health Organization classification, were included. Cases with an uncertain histopathological diagnosis and those with metastatic lesions to the parotid gland, as well as malignant soft tissue tumours and tumours penetrating the gland, were excluded.
DNA extraction
Five sections 4 μm in thickness were cut from each paraffin-embedded tissue block and inserted in Eppendorf tubes. Deparaffinization was performed by heating, and DNA was extracted using a QIAamp DNA Mini Kit (Qiagen, Valencia, CA, USA).
Mutational analysis
The most frequent mutations in the PIK3CA , KRAS , and BRAF genes reported in the COSMIC database were analyzed. These are PIK3CA exon 9 and exon 20, KRAS exon 2 (codons 12 and 13), and BRAF exon 15.
PCR amplification and direct sequencing
For the mutational analysis, direct sequencing was performed. In brief, polymerase chain reaction (PCR) amplification was done in a 50-μl reaction volume containing 50 ng of sample DNA as a template. The reaction was performed using primers specific for PI3KCA exons 9 and 20, KRAS exon 2, and BRAF exon 15. For PIK3CA exon 9, these were forward primer GATTGGTTCTTTCCTGTCTCTG and reverse primer CCACCCTATCAATTTACAACCA; for exon 20 (two sets of primers) these were forward primer (1) GGGGTAAAGGGAATCAAAAG and reverse primer (1) CCTATGCAATCGGTCTTTGC, and forward primer (2) TTGCATACATTCGAAAGACC and reverse primer (2) GGGGATTTTTGTTTTGTTTTG. For KRAS exon 2, the primers were forward primer GGCCTGCTGAAAATGACTGAATATAA and reverse primer AAAGAATGGTCCTGCACCAGTA. For BRAF exon 15, they were forward primer TGCTTGCTCTGATAGGAAAATG and reverse primer AGCATCTCAGGGCCAAAAAT.
To rule out PCR artefacts and sequencing errors, all amplicons were sequenced with bidirectional coverage or in duplicate with unidirectional coverage.
Direct sequencing of the PCR products ( PIK3CA exon 9, 486-bp fragment; PIK3CA exon 20, 524-bp and 469-bp fragments; KRAS exon 2, 170-bp fragment; BRAF exon 15, 228-bp fragment) was performed with forward and reverse primers using BigDye Terminator Cycle Sequencing Kit reagents and an ABI PRISM 3700 DNA Analyzer (Applied Biosystems, Foster City, CA, USA).
Results
The histopathological diagnosis was confirmed in all cases by two of the authors (BS and AH). Of the 30 cases identified, sufficient DNA for mutational analysis was available for 21 cases. The clinical data of the cases, including age, sex, location, and stage, are summarized in Table 1 .
| Sex, n | |
| Male | 10 |
| Female | 11 |
| Age, years, mean (range) | 56 (22–76) |
| Histological type, n | |
| Adenoid cystic carcinoma | 6 |
| Adenocarcinoma, NOS | 6 |
| Mucoepidermoid carcinoma | 4 |
| Acinic cell carcinoma | 2 |
| Carcinoma ex pleomorphic adenoma | 2 |
| Lymphoepithelial carcinoma | 1 |
| Clinical stage, n | |
| I | 4 |
| II | 8 |
| III | 2 |
| IVa | 6 |
| IVb | 0 |
| IVc | 1 |
PIK3CA exon 20 mutational analysis by PCR was successful for 17 of the 21 samples. Mutational analysis did not reveal any mutation in G1049R or H1047Y/L/R as described in the COSMIC database. In one case, however, a stop mutation was detected in W1051; this mutation has not been described previously. The DNA sequencing chromatogram is presented in Fig. 1 ; the mutation was validated through bidirectional sequencing analysis. The patient with this mutation was a 39-year-old male smoker who had adenocarcinoma NOS of the parotid gland with facial nerve involvement (T4N0M0). A radical parotidectomy was performed, with complete cure of the disease. The patient was well after 20 years of follow-up. With the discovery of this previously undescribed mutation, sequencing of the entire exon 20 was performed. The PCR product was available for 14 samples; no additional mutation was found following sequencing.
Stay updated, free dental videos. Join our Telegram channel
VIDEdental - Online dental courses
