Introduction
This study aimed to investigate the role of lactoferrin (LF) in the mechanical strain–induced osteogenesis of nontransformed osteoblastic cells (MC3T3-E1 cells) and related mechanism.
Methods
MC3T3-E1 cells were cultured in vitro and treated with 100 μg/mL LF, followed by a 2000 μ mechanical strain load. U0126 was used to determine the role of extracellular signal–regulated kinase 1/2 (Erk1/2). Alizarin red S staining was performed to observe the cell mineralization potential. The osteogenic results were analyzed by reverse transcription–polymerase chain reaction and western blotting.
Results
The expression of Col1 , Alp , Ocn , Bsp , and Opn mRNA and p-Erk1/2 proteins was significantly upregulated under mechanical strain load. In addition, mineralized nodule formation was increased. After adding LF, the expression of the biomarkers and the formation of mineralized nodules were further promoted. On treatment with the Erk1/2 inhibitor U0126, the expression of Col1 , Alp , and p-Erk1/2 mRNA and protein was significantly downregulated.
Conclusions
These findings demonstrate that LF promotes osteogenic activity by activating osteogenesis-related biomarkers, corroborating that the effects of mechanical strain depend on Erk1/2 signaling pathway.
Highlights
- •
Mechanical strain induced osteogenesis in nontransformed osteoblastic cells.
- •
Lactoferrin (LF) corroborated the osteogenic effects of the mechanical strain of cells.
- •
U0126 blocked the effect of LF and mechanical strain on cells.
- •
LF promotes osteogenesis induced by strain in an Erk1/2-dependent manner.
Mechanical load makes the bone update and repaired itself, which is essential to maintain bone integrity. , Bone structure and mechanical load are relevant; deficiency or excess of mechanical load could result in pathologic bone changes. , Mechanical loads have been reported to activate osteogenesis-related signal transduction cascades and promote osteogenic activity. Moreover, the mechanical strain is conducive to bone remodeling by promoting the proliferation of osteoblasts; thus, bone homeostasis is achieved. , Based on these principles, mechanical strain is applied in the orthodontic clinic, such as midpalatal expansion to promote bone formation; therefore, a harmonious skeletal relationship could be obtained.
As a member of the transferrin family, lactoferrin (LF) is a natural iron-binding glycoprotein of approximately 80 kDa that primarily exists in various exocrine fluids and secondary granules in neutrophils. LF can stimulate osteogenic proliferation and differentiation and reduce the apoptosis of osteoblasts, which plays a physiological role in bone growth and metabolism. , Continuous LF administration for 5 days into the skulls of adult mice significantly increased osteogenesis, and the increase in volume is dependent on the dose of LF. Moreover, LF promotes mitosis in osteoblast-like cells at physiological concentrations and proliferation of human SaOS-2 osteoblast-like cells. Our previous study showed that LF can promote bone formation and mineralization in midpalatal sutures during rapid expansion in rats. However, the underlying mechanisms remain inconclusive.
The extracellular signal–regulated kinase 1/2 (Erk1/2) signaling pathway is sensitive to mechanical stimulation; this pathway converts external mechanical signals into intracellular biochemical signals and then regulates cell proliferation and differentiation. Furthermore, LF reportedly induces Erk1/2 phosphorylation in osteoblast-like cells, thus promoting cell proliferation and survival. , MC3T3-E1 is a mouse skull clonal cell line that can undergo directional osteogenic differentiation and is ideal for studying the biological behavior of osteoblast proliferation and differentiation. ,
Therefore, we predicted that LF could promote osteogenesis induced by mechanical strain in vitro and that the Erk1/2 signaling pathway plays a significant role in this process. This study was conducted to investigate the effect of LF on the osteogenesis of MC3T3-E1 cells induced by mechanical strain load.
Material and methods
All experimental procedures were performed at the State Key Laboratory of Oral Diseases of Sichuan University in China. The immortalized murine osteoblast cell line MC3T3-E1 was purchased from the cell bank of the Chinese Academy of Sciences (Shanghai, China) and cultured in α-Minimum Essential Medium supplemented with 10% fetal bovine serum (Gibco, Grand Island, NY) and 1% penicillin-streptomycin (HyClone, Logan, Utah) incubated at 37°C with 5% CO 2 . To assess Erk1/2 regulation, we incubated the medium with the Erk1/2 inhibitor U0126 (5 μM) for 2 hours, followed by treatment with LF (100 μg/mL) for 24 hours. MC3T3-E1 cells were then treated for 3, 6, 12, 18, and 24 hours with a Forcel 4-point bending system (National Patent Numbers in China, ZL01256849.X; Fig 1 ), and then the expression of osteogenesis-related genes was assessed. The strain frequency was 0.5 Hz, and the deformation of the stress plate was assessed at a strain of 2,000 μ (strain is defined as the ratio of the change in length to the original length, 2,000 μ strain is equivalent to a 2% change in the cell length). Cells in the control group were placed next to the device to maintain the same environment. After strain-loading, the cells were harvested for analysis.
Total RNA was extracted from the cells using TRIzol reagent (Invitrogen, Carlsbad, Calif) according to the manufacturer’s instructions. A NanoDrop spectrophotometer (Thermo Fisher Scientific, Waltham, Mass) was used to measure the optical density (260/280 nm ratio) to determine the RNA concentration (acceptable range, 1.8-2.1). Reverse transcription of total RNA into cDNA was performed using a cDNA Synthesis Kit (Thermo Fisher Scientific) according to the manufacturer’s protocol. cDNA amplification was carried out using primers designed by Bao Biological Co, Ltd (Dalian, China) ( Table ), and reverse transcriptase polymerase chain reaction was carried out in a 20-μL mixture with Maxima SYBR Green qPCR Master Mix (Thermo Fisher Scientific) in an ABI 7300 instrument (Applied Biosystems, Foster City, Calif). Gapdh , a housekeeping gene, was used as a control.
| Gene | Forward primer sequence (5′-3′) | Reverse primer sequence (5′-3′) |
|---|---|---|
| Gapdh | TGGTGAAGGTCGGTGTGAAC | GCTCCTGGAAGATGGTGATGG |
| Col1 | CTGGCGGTTCAGGTCCAAT | TTCCAGGCAATCCACGAGC |
| Alp | GATGTGGAATACGAACTGGATG | TGGGAATGCTTGTGTCTGG |
| Bsp | AGAGCGGTGAGTCTAAGGAGT | TGCCCTTTCCGTTGTTGTCC |
| Ocn | ATCTTTCTGCTCACTCTGCTG | CTTATTGCCCTCCTGCTTGG |
| Opn | TAGGAGTTTCCAGGTTTCTGATGA | CTGCCCTTTCCGTTGTTGTC |
MC3T3-E1 cells were seeded at 2 × 10 4 cells/well into 6-well culture plates and cultured in mineralization solution for 21 days. After washing with phosphate-buffered saline, the cells were fixed with 4% paraformaldehyde at room temperature for approximately 15 minutes before Alizarin red S staining (2 mL/well), which was conducted for 5 minutes at ambient temperature. Finally, the cells were rinsed with deionized water. Mineralized nodules were observed with an IX70 microscope (Olympus, Tokyo, Japan). The results were presented as a percentage of the positive staining area per field of view (magnification, ×100).
For western blotting analysis, MC3T3-E1 cell samples were harvested using Cell Lysis Buffer (Beyotime, Shanghai, China) in accordance with the manufacturer’s instructions. After determining the protein concentration using a bicinchoninic acid kit (Beyotime), the proteins were separated by sodium dodecyl sulfate–polyacrylamide gel electrophoresis and then electrotransferred onto polyvinylidene difluoride membranes. After blocking for 2 hours with 5% nonfat dry milk in Tris-buffered saline with Tween-20, the membranes were probed overnight at 4°C with the following primary antibodies: anti-Erk1/2 (1:1000 dilution, Abcam), anti-p-Erk1/2 (1:1000 dilution, Abcam), anti-Alp (1:1000 dilution, Abcam), anti-Col1 (1:500 dilution, Abcam), and anti-Gapdh (1:1000 dilution, Abcam). The membranes were probed with horseradish peroxidase-conjugated secondary antibody for 2 hours at ambient temperature. Immunoreactive proteins were detected with an enhanced chemiluminescence kit (Millipore; Billerica, Mass) according to the manufacturer’s instructions. The intensity of each band was quantified using Image-Pro Plus software (version 6.0; Media Cybernetics, Rockville, Md) and normalized to that of the corresponding loading controls.
Statistical analyses
The data were analyzed using a 1-way analysis of variance in each group, followed by the least significant difference test for post-hoc analysis. All experiments were performed in triplicate, and SPSS statistical software (version 16.0; SPSS Inc, Chicago, Ill) was used. Experimental results were expressed as the mean ± standard deviation. Statistical significance difference was defined as P <0.05.
Results
In general, Col1 , Alp , Bsp , Ocn , and Opn mRNA was significantly upregulated with the strain load compared with the control group at 6 hours posttreatment. Alp and Opn mRNA expression peaked at 12 hours and then insignificantly decreased at 18 hours. Bsp and Col1 mRNA expression was upregulated over time, and Ocn mRNA expression levels peaked at 18 hours ( Fig 2 , A ; Supplementary Table I ). Western blotting analysis revealed that p-Erk1/2 protein was significantly increased after 3 hours of mechanical strain, and its expression increased over time. However, Erk1/2 protein expression was not significantly altered overall ( Fig 2 , B and C ; Supplementary Table II ).
