Abstract
Objectives
Dental anomalies are often associated with inherited diseases and are frequently seen in the field of pediatric dentistry. Dentin disorders are caused by genetic mutations of genes expressed in dental mesenchyme and these genetic mutations also cause skeletal dysplasia. However, only little genes are identified as the responsible gene of dentin disorders and therefore the genetic mechanism is poorly understood. Here, we identified the dental mesenchymal cell-specific genes using single-cell RNA-sequence (scRNA-seq) to clarify the pathogenesis of dentin disorders. Furthermore, we examined the association of inherited disease with dentin or skeletal abnormality using human disease database.
Materials and methods
scRNA-seq were performed using post-natal day (P) seven mice incisor. Total 6260 cells of scRNA-seq dataset was obtained. Top 20 differentially expressed genes (DEGs) in odontoblast cluster and dental pulp cluster were identified. Inherited diseases of DEGs and their Clinical Synopsis were examined using Online Mendelian Inheritance in Man (OMIM).
Results
The prevalence of inherited disease was 17/40 genes (42.5 %) and dental anomalies-associated inherited diseases were 12/35 diseases (34.3 %); 2.8 % in enamel abnormality, 14.3 % in dentin abnormality, and 17.1 % in other abnormality. The prevalence of dentin abnormality was 33.3 % in odontoblast and 7.7 % in dental pulp-associated diseases. The prevalence of skeletal abnormality in identified inherited diseases was 85.7 %.
Conclusion
The DEGs in dental mesenchymal cells were highly associated with dentin abnormality and skeletal abnormality. Identification of dental mesenchymal cell specific genes using scRNA-seq may uncover the novel genetic mechanism of dentin disorders.
1
Introduction
Dentin disorders generally affect both deciduous and permanent teeth, therefore there are great impacts on patients’ quality of life from childhood [ ]. Once these patients’ teeth have defect or exfoliation of enamel, the exposed abnormal dentin is rapidly eroded, and pulp exposure causes endodontic diseases. Even more, the dentin disorder typically accompanies the abnormal structure of pulp cavity and root canals, therefore endodontic treatment would have a difficulty and lead to poor-prognosis of treated teeth [ ]. For these reasons, it is important to diagnose the dentin diseases in early stage of life by pediatric dentist and prevent such a worst scenario. The well-known sign of dentin disorder is discolored teeth to blue-gray or yellow-brown and translucent, giving them as opalescent appearance [ ]; although this notification needs to be paid attention. This sign is observed in severe case, but not in mild case and several types of dentin disorders [ , ]. In mild case of dentin disorders, it can be predicted from quick expansion of dental caries; however, the dentin layer cannot be observed by directory from outside, therefore the diagnosis of dentin disorder is more difficult than enamel disorders. Notably, it is considerable that disturbance of biomineralization affects both enamel and dentin formation [ ]. In the case of teeth have enamel abnormalities, it would cause more complicated problems in diagnosis of dentin disorders. Therefore, it would be important to have another supportive evidence to diagnose dentin disorder than the appearance of teeth. The possible approaches are genetic examination of inherited diseases and medical examination of family history of systemic diseases, while the molecular mechanism of dentin disorders is poorly understood. The accumulation of knowledge and information of genetic analyses in dentin disorder would be required.
Most of the dentin disorder are caused by mutation of genes expressed in dental mesenchyme [ ]. Hereditary human dentin disorders are classically divided into 5 types by Shields classification [ ]; dentinogensis imperfecta (DGI) type I, II, III and dentin dysplasia (DD) type I, II. The incidences of DGI and DD are 1 in 6000 to 1 in 8000 and 1 in 100,000, respectively. DGI type I is inherited with osteogenesis imperfecta (OI) and caused by genetic mutation of COL1A1 and COL1A2 [ ]. In Online Mendelian Inheritance in Man (OMIM) database, now DGI type I is classified as OI (MIM number #166240). All other form of DGI and DD is caused by the mutation of DSPP [ , ]. Further, there is a deep association between dentin anomalies and skeletal dysplasia. Several skeletal dysplasia is reported to accompany dentin anomalies; for example, Ehlers-Danlos syndrome [ ], Goldblatt syndrome (#184260, Odontochondrodysplasia 1) [ ], Schimke immunoosseus dysplasia (#242900) [ ], and Brachioskeletogenital syndrome (#211380, Elsahy-waters syndrome) [ ]frequently accompany dentin anomalies. From the standpoint of tissue composition, dentin and bone have high similarity that these are composed from 70% of hydroxyapatite, 20% of organic protein, and 10% of water [ ]. The organic components derive from 90% of type I collagen and other components are non-collagen proteins such as dentin sialophosphoprotein (DSPP), dentin matrix acidic phosphoprotein 1 (DMP1), osteocalcin (BGLAP), bone gla protein (BGP), matrix gla protein (MGP), osteopontin (SPP1), bone sialoprotein (BSP), osteonectin (SPARC), and proteoglycans [ ]. Furthermore, they share key mechanisms of formation in regulation of ion homeostasis, hormones, and important transcription factors (e.g. RUNX2, SP7) and signaling molecules (e.g. BMP, WNT pathways) [ , , ]. For these reasons, genetic analyses of dentin disorders will contribute to uncover the pathogenesis of skeletal dysplasia.
We recently established the single-cell RNA-sequence (scRNA-seq) library of tooth germ and identified several genes which show specific expression in dental mesenchymal cell types [ ]. We hypothesized that these genes may involve in the pathogenesis of dentin disorders in human. However, the relationship between these marker genes and human inherited diseases has not been elucidated yet. Previously, we examined the association of the dental epithelial cell type-specific genes on human inherited diseases by integration of scRNA-seq and OMIM. As a result, we found that approximately 35 % of identified human inherited diseases were reported to have dental anomalies [ ], which is higher prevalence ratio than other reports [ , ]. Furthermore, this screening method was useful to clarify the association of systemic symptoms, such as skeletal abnormality and neurogenic abnormality, on the identified inherited diseases. Here, we aimed to clarify the molecular mechanism of dental disorders by identification of human inherited diseases which associate to dental mesenchymal cell type-specific genes, using integration of scRNA-seq and OMIM database.
2
Materials and methods
2.1
Animals
The animal experiments protocols were approved by the Ethics Committee of the Tohoku University Animal Experiment Center (2020-016-05). The tissue specimens of post-natal day (P) 1 mice were dissected from more than three littermates and used for experiments.
2.2
scRNA-seq analysis
We previously deposited the dataset of scRNA-seq obtained from P7 mice incisor in NCBI GEO database (GSE146855) and used for this study. The dataset contains gene expression profile of 6260 dental cells [ ]. Clustering and differential gene expression analysis were performed essentially similar to previous research [ ]. Briefly, secondary analyses were performed using the Cell Ranger Single-Cell Software Suite v2. 1.0 (10x Genomics). Clustering was performed with graph-based algorithm. The p-values were adjusted using the Benjamini-Hochberg correction for multiple tests. We considered the genes with log2-fold change >1.0 and p-value <0.1 to be differentially expressed. List of top 20 differentially expressed genes (DEGs) between clusters was provided in Table A. 1 . Clusters were then classified with known dental cell marker genes in top 20 DEGs ( Table A. 2 ). Expression level of marker gene was visualized using Loupe Cell Browser v6. 4.0 (10x Genomics).
2.3
OMIM search strategy and data selection criteria
Differential expressed genes between clusters in scRNA-seq dataset were analyzed in OMIM website ( https://omim.org ). Gene entry of top 20 differential expressed genes in odontoblast cluster and dental pulp cluster were searched and their inherited diseases were identified from phenotype entry. Dental anomalies were extracted from “Teeth” section in Clinical Synopsis and classified into three groups; enamel abnormality, dentin abnormality, and others. Inherited diseases which do not have “Teeth” section, or which were reported as no dental abnormality were categorized as “no report of dental anomalies”. For systemic symptoms accompanied with inherited diseases, “SKIN”, “SKEKETAL”, and “NEUROGENIC” sections were analyzed from Clinical Synopsis.
2.4
Cell culture
The mouse dental papilla (mDP) cell was established as previously described [ ]. mDP cells were maintained with Dulbecco’s modified Eagle’s medium (DMEM) (Invitrogen) supplemented with 10 % bovine serum and an antibiotic-antimycotic mixture at 37 °C in a humidified atmosphere containing 5 % CO 2 .
2.5
Real-time polymerase chain reaction (PCR)
mDP cell is plated at 2 × 10 4 cell density in 35 mm dish and corrected after 2, 4, 6, 8, 10 days of plating. The total RNA was isolated using the RNeasy Kit (Qiagen) according to the manufacturer’s protocol. Total RNA (1 μg) was used to synthesize cDNA using the SuperScript™ VILO™ MasterMix (Invitrogen), and real-time PCR was performed using SYBR® Select Master Mix (Applied Biosystems) using a StepOne® Real‐Time PCR system (Thermo Fisher Scientific) as previously described [ ]. The primer sequences used in this study are following; glyceraldehyde‐3‐phosphate dehydrogenase (Gapdh) , 5′‐CTCGCTCCTGGAAGATGGTG‐3′, and 5′‐GGTGAAGGTCGGTGTGAACG‐3′; Secretin (Sct) , 5′‐GCTTCTGCCCAGGCTGTC‐3′, and 5′‐GCCTGGTTGTTTCAGTCCAC‐3′.
3
Results
3.1
Inherited disease associated with dental mesenchymal cell DEGs
We previously performed scRNA-seq using P7 mice incisor and the dataset was deposited in NCBI GEO (GSE146855). The gene expression analyses, clustering analyses were performed and total 2542 cells of dental mesenchymal cells were classified into odontoblast cluster (727 cells) and dental pulp cluster (1815 cells) [ ]. Differential expression analysis was performed between clusters and the top 20 DEGs in odontoblast and dental pulp were identified ( Table. A. 1 ). Among them, known marker genes of odontoblast and dental pulp were used for cluster annotation ( Table. A. 2 ). The gene and inherited disease entries were searched using OMIM and information regarding gene entry, gene locus, inherited disease entry, MIM number, dental anomaly, systemic symptom of SKIN, SKELETAL, and NEUROGENIC was summarized in Table 1 . Total 40 DEGs were analyzed and 35 disease entry were identified as DEGs-associated inherited diseases. As example, COL1A2 (chromosome 7q21.3) was raised as a DEG of dental pulp and it is responsible gene of Osteogenesis imperfecta, type III, AD (#259420), and it associates with DGI. This inherited disease accompanies systemic symptoms in SKELETAL, and NEURGENIC, but not in SKIN. Several DEGs, such as sphingomyelin phosphodiesterase 3 ( SMPD3 ) in odontoblast, have not reported as responsible genes of inherited diseases although these genes have reported to be expressed in odontoblast [ ]. We classified the DEGs into two groups; DEGs with report of inherited diseases or DEGs without report of inherited diseases, and then counted the number of DEGs ( Table 2 ). The prevalence of inherited disease in DEGs was 17/40 genes (42.5 %) as total; eight genes in odontoblast, and nine genes in dental pulp. The ratio of disease-associated genes in top 20 DEGs was 40.0 % (8/20 genes) in odontoblast, and 45.0 % (9/20) in dental pulp. The proportion of responsible genes for inherited disease in each cell type was shown in Fig. 1 . 42.5 % of DEGs have been reported as responsible genes for inherited disease; 20.0 % in odontoblast, and 22.5 % in dental pulp. 57.5% of DEGs have not been reported as disease-associated genes yet.
| Cell type | Gene | Locus | Inherited disease | MIM | Dental anomaly | SKIN | SKELETAL | NEUROGENIC |
|---|---|---|---|---|---|---|---|---|
| Odontoblast | DMP1 | 4q21.22 | Hypophosphatemic rickets, AR | 241520 | Dentin defects | No | Yes | No |
| SMPD3 | 16q22.1 | |||||||
| PLAC8 | 4q21.22 | |||||||
| BGLAP | 1q22 | |||||||
| SCT | 3p14.3 | Spondylocarpotarsal synostosis syndrome, AR | 272460 | Enamel hypoplasia | No | Yes | No | |
| DKK1 | 10q21.1 | |||||||
| SGMS2 | 4q25 | Calvarial doughnut lesions with bone fragility with or without spondylometaphyseal dysplasia, AD | 126550 | Dental caries | No | Yes | Yes | |
| IFITM5 | 11p15.5 | Osteogenesis imperfecta, type V | 610967 | Dentinogenesis imperfecta | No | Yes | No | |
| DCN | 12q21.33 | Corneal dystrophy, congenital stromal, AD | 610048 | no report | No | No | No | |
| COX4I2 | 20q11.21 | Exocrine pancreatic insufficiency, dyserythropoietic anemia, and calvarial hyperostosis, AR | 612714 | Maldentition | No | Yes | Yes | |
| GCHFR | 15q15.1 | |||||||
| OMD | 9q22.31 | |||||||
| IBSP | 4q22.1 | |||||||
| LUM | 12q21.33 | |||||||
| PTN | 7q33 | |||||||
| SERPINF1 | 17p13.3 | Osteogenesis imperfecta, type VI, AR | 613982 | no report | No | Yes | Yes | |
| CDKN1C | 11p15.4 | Beckwith-wiedemann syndrome, AD | 130650 | no report | Yes | Yes | No | |
| IMAGE syndrome, AD | 614732 | no report | No | Yes | Yes | |||
| PCOLCE | 7q22.1 | |||||||
| CRABP1 | 15q25.1 | |||||||
| IFITM1 | 11p15.5 | |||||||
| Dental pulp | MPZ | 1q23.3 | Charcot-marie-tooth disease, dominant intermediate D, AD | 607791 | no report | No | No | Yes |
| Charcot-marie-tooth disease, type 1B, AD | 118200 | no report | No | Yes | Yes | |||
| Charcot-marie-tooth disease, type 2I, AD | 607677 | no report | No | Yes | Yes | |||
| Charcot-marie-tooth disease, type 2J, AD | 607736 | no report | No | Yes | Yes | |||
| Dejerine-sottas disease, AD AR | 145900 | no report | No | Yes | Yes | |||
| Hypomyelinating neuropathy, congenital, 2, AD | 618184 | no report | No | Yes | Yes | |||
| Roussy-levy syndrome, AD | 180800 | no report | No | Yes | Yes | |||
| OGN | 9q22.31 | |||||||
| SFRP2 | 4q31.3 | |||||||
| MMP13 | 11q22.2 | Metaphyseal anadysplasia 1, AD | 602111 | no report | No | Yes | No | |
| Metaphyseal dysplasia, spahr type, AR | 250400 | no report | No | Yes | Yes | |||
| SPP1 | 4q22.1 | |||||||
| BMP3 | 4q21.21 | |||||||
| SFRP4 | 7p14.1 | Pyle disease, AR | 265900 | Delayed tooth eruption | No | Yes | No | |
| TAGLN | 11q23.3 | |||||||
| COL12A1 | 6q13-q14.1 | Ullrich congenital muscular dystrophy 2, AR | 616470 | no report | No | Yes | Yes | |
| Bethlem myopathy 2, AD | 616471 | no report | Yes | Yes | Yes | |||
| NCAM1 | 11q23.2 | |||||||
| POSTN | 13q13.3 | |||||||
| COL3A1 | 2q32.2 | Ehlers-danlos syndrome, vascular type, AD | 130050 | Early loss of teeth | Yes | Yes | No | |
| Polymicrogyria with or without vascular-type EDS, AR | 618343 | Crowded teeth | Yes | Yes | Yes | |||
| IGF1 | 12q23.2 | Growth retardation with deafness and mental retardation due to IGF1 deficiency, AR | 608747 | no report | No | Yes | Yes | |
| MBP | 18q23 | |||||||
| NTS | 12q21.31 | |||||||
| COL1A2 | 7q21.3 | Combined osteogenesis imperfecta and ehlers-danlos syndrome 2, AD | 619120 | Dental overcrowding | Yes | Yes | No | |
| Ehlers-danlos syndrome, arthrochalasia type, 2, AD | 617821 | no report | Yes | Yes | Yes | |||
| Ehlers-danlos syndrome, cardiac valvular type, AR | 225320 | no report | Yes | Yes | No | |||
| Osteogenesis imperfecta, type II, AD | 166210 | no report | Yes | Yes | No | |||
| Osteogenesis imperfecta, type III, AD | 259420 | Dentinogenesis imperfecta | No | Yes | Yes | |||
| Osteogenesis imperfecta, type IV, AD | 166220 | Dentinogenesis imperfecta | No | Yes | No | |||
| Osteoporosis, postmenopausal, AD | 166710 | no report | No | Yes | No | |||
| SFRP1 | 8p11.21 | |||||||
| ACTA2 | 10q23.31 | Aortic aneurysm, familial thoracic 6, AD | 611788 | no report | No | No | No | |
| Moyamoya disease 5, AD | 614042 | no report | No | No | No | |||
| Multisystemic smooth muscle dysfunction syndrome, AD | 613834 | no report | No | No | Yes | |||
| ALX1 | 12q21.31 | Frontonasal dysplasia 3, AR | 613456 | Protruding teeth | No | Yes | Yes | |
| CYR61 | 1p22.3 |
Stay updated, free dental videos. Join our Telegram channel
VIDEdental - Online dental courses
