Genome-wide association study for mandibular prognathism using microsatellite and pooled DNA method

Introduction

The purpose of this study was to extend an association study from chromosome 1 to the whole genome (genome-wide association study) to find susceptibility loci of mandibular prognathism.

Methods

Two hundred forty patients diagnosed with mandibular prognathism and 360 healthy controls of Japanese descent were recruited. The typing of microsatellites covering the whole genome was conducted using a pooled DNA method. Upon completion of the first and second screenings with pooled DNA, the positive microsatellite markers from both the first and second typings were retyped using individual-subject DNA samples to confirm the significance of allele frequency.

Results

Six microsatellites ( D1S0411i , D1S1358i , D3S0810i , D6S0827i , D7S0133i , and D15S0154i ) showed differences between allele frequencies of the subjects and controls at P <0.001. D1S0411i , D1S1358i , D3S0810i , D6S0827i , D7S0133i , and D15S0154i were located on chromosomes 1p22.3, 1q32.2, 3q23, 6q23.2, 7q11.22, and 15q22.22, respectively. SSX2IP , PLXNA2 , RASA2 , TCF21 , CALN1 , and RORA were suggested as candidate genes.

Conclusions

The genome-wide association study using microsatellites suggested that 6 loci (1p22.3, 1q32.2, 3q23, 6q23.2, 7q11.22, and 15q22.22) were susceptibility regions of mandibular prognathism. The locus 1p22.3 was supported by a previous linkage analysis, and the other 5 were novel loci.

Highlights

  • Six microsatellites showed differences in allele frequency between subjects and controls.

  • Six loci of chromosome were susceptibility regions of mandibular prognathism.

  • One locus was supported by a previous linkage analysis, and the other 5 were novel.

Mandibular prognathism (Online Mendelian Inheritance in Man number 176700), skeletal Class III malocclusion in orthodontics, is a multifactorial phenotype. Some linkage analyses and supplementary association studies for mandibular prognathism have been carried out in various races. From the results of linkage analysis, Yamaguchi et al suggested that chromosomes 1p36, 6q25, and 19p13.2 were associated with mandibular prognathism in Japanese and Korean families. Association studies examining the putative susceptibility locus close to 1p36 suggested that Matrilin-1 (cartilage matrix protein) and EPB41 (erythrocyte membrane protein band 4.1) were candidate genes of the phenotype. In contrast, another linkage analysis of Brazilian families found that 1p36, 6q25, and 19p13.2 were not associated with the phenotype. Furthermore, Frazier-Bowers et al suggested from results of linkage analysis of Colombian Hispanic families that 5 susceptibility loci—1p22.1, 3q26.2, 11q22, 12q13.13, and 12q23—were related to the phenotype. An association study suggested that MYO1H (myosin 1H) located on 12q24.11, close to 12q23, was a candidate gene of the phenotype. Two more linkage analyses examining the susceptibility loci of the phenotype have been reported. Genome-wide association study (GWAS) has been proposed as an alternative strategy for linkage analysis. There have been no reports on GWAS of mandibular prognathism. The linkage analyses of Yamaguchi et al and Frazier-Bowers et al suggested that susceptibility loci of mandibular prognathism were on chromosome 1. We therefore show the results of an association study at chromosome 1 for mandibular prognathism.

The preliminary association study of Japanese patients suggested that 2 loci (1q32.2 and 1p22.3) were susceptibility regions of mandibular prognathism and that PLXNA2 and SSX2IP were candidate genes. 1p32.2 was a novel locus, and 1p22.3 corroborated the previous suggestive linkage analysis results. After our preliminary study on chromosome 1, more linkage or association analyses on susceptibility loci of the disease have been reported in the last 2 years. The objective of this study was to extend the data gained from our previous association study of mandibular prognathism on chromosome 1 to the whole GWAS, using the same cohort and methodology as previously described.

Material and methods

The study protocol was approved by the ethics committees of the School of Dentistry and Pharmaceutical Science of Hokkaido University and the School of Medicine of Tokai University. All subjects gave written informed consent for participation in the study. Two hundred forty subjects with mandibular prognathisms and 360 healthy controls of Japanese descent were recruited as previously described. Inclusion and exclusion criteria for subjects diagnosed with mandibular prognathism were also the same as described previously. There were no biologic relationships among the subjects.

Genomic DNA was isolated from whole blood cells using the QIAamp DNA Blood Maxi Kit (QIAGEN, Hilden, Germany). Microsatellite genotyping was performed as described in our previous study using a pooled DNA method. The allele frequencies for pooled DNA typing were estimated by the height of each peak. To reduce the number of pseudo-positives resulting from type I errors, 2 steps of screening were performed to sequentially replicate the results in each pooled sample. Pooled DNA was screened using a dense panel of 23,465 microsatellites covering the whole genome in the first screening. Microsatellites showing statistical significance ( P <0.05) in the first screening were subjected to the second screening ( Fig ).

Fig
Flow chart of the first and second screenings and individual genotyping. Independent samples were used for the first and second screenings. In individual genotyping, we removed 18 microsatellites from 36 positive microsatellites because the 18 microsatellites deviated from the Hardy-Weinberg equilibrium or coded gene deserts. Individual genotyping was performed in the full sample of 240 subjects and 360 controls.

After the first and second typings using pooled DNA, microsatellite markers that showed a significant association with mandibular prognathism in both the first and second typings were further screened using individual-subject DNA samples from the pooled DNA set (240 subjects and 360 controls). Amplification of each microsatellite from each DNA sample was conducted using polymerase chain reaction to verify significant associations ( Fig ). The polymerase chain reaction conditions and method for analyzing polymerase chain reaction products were the same as previously described. The allele frequencies for individual genotyping were estimated by the height of each peak.

Statistical analysis

Two types of the Fisher exact test for 2 × 2 contingency tables for each allele and 2 × m contingency tables for each locus (where m is the number of alleles for the marker) were used to determine the statistical significance for the subject-control association. The level of statistical significance was set at P <0.05. The results from each second screening were tested for deviation from the Hardy-Weinberg equilibrium using an expectation-maximization approach as implemented in GENEPOP. The result from individual genotyping was tested using the Bonferroni statistical correction for multiple testing to reduce type I errors.

Results

Three thousand eight hundred fifty-nine microsatellite markers showed a statistically significant ( P <0.05) association with mandibular prognathism in the first screening conducted with 23,465 microsatellites on the whole genome ( Fig ). For reducing type I errors, a further screening step was performed using the 3859 microsatellites that showed a significant association with mandibular prognathism. Microsatellites that showed a different pattern of peaks between the first and second screenings were excluded. Thirty-six microsatellites showed a statistically significant association with mandibular prognathism in the second screening ( Fig ).

We then performed individual genotyping for the 36 positive microsatellites that passed both the first and second screenings ( Fig ) using individual-subject DNA from the pooled DNA set. We excluded 18 microsatellites because they deviated from the Hardy-Weinberg equilibrium or coded gene deserts.

Using the full sample of 240 subjects and 360 controls, the remaining 18 positive microsatellite markers were typed ( Table I ). Six microsatellites ( D1S0411i , D1S1358i , D3S0810i , D6S0827i , D7S0133i , and D15S0154i ) showed differences between allele frequencies of the subjects and controls at P <0.001 (not sufficient for a significant threshold of Bonferroni correction): the first ( D1S0411i : P = 6.66 × 10 −4 ) was located on chromosome 1p22.3, the second ( D1S1358i : P = 4.22 × 10 −4 ) was located on chromosome 1q32.2, the third ( D3S0810i : P = 9.24 × 10 −4 ) was located on chromosome 3q23, the fourth ( D6S0827i : P = 6.61 × 10 −4 ) was located on chromosome 6q23.2, the fifth ( D7S0133i : P = 8.45 × 10 −4 ) was located on chromosome 7q11.22, and the sixth ( D15S0154i : P = 5.71 × 10 −5 ) was located on chromosome 15q22.22 ( Table II ). These cytobands referred to the GRCh build 37/hg19.

Table I
Eighteen microsatellite markers that showed significant association with mandibular prognathism after pooled DNA genotyping
Microsatellite Cytoband Physical position of amplicon Primer sequence
From To Forward Reverse
D15S0154i 15q22.22 61510259 61510524 GTGGCTCATAAATAGATCATGA AGCTTGAATATTACAGGTCCTAAC
D1S1358i 1q32.2 208365606 208365706 AGTCACCACCTGCCATATG TCCAGGGTTGTCTTGTCC
D6S0827i 6q23.2 134158402 134158641 GCTGCGCAATTAGAATAATAAA GCACAACCAATTTCTTGATG
D1S0411i 1p22.3 85179329 85179616 TGCTTGAACCTGATAGGTAGAG GGCTTGTAGATGCTAGGAAAG
D7S0133i 7q11.22 71515838 71516140 CCAATTAACTAATTCTACCATCAC ATTAGCCAAGCATGGTATAATC
D3S0810i 3q23 141366397 141366800 TGGAGTCATCTAATGGCAC TCGCTAATCTAGTCAGTTGAAG
D3S0830i 3p24.3 23566089 23566434 ATCATGGAACTAGAATAAGCCT AAGCCACTAAGTCTGTAACAGTAG
D4S0965i 4q28.2 129784002 129784098 GTTACAGAAGATACTCCTGGCAG ACAGAGACATGGATGGACAC
D19S897 19q13.2 38759364 38759455 AGGATTTCCCCAACAGC TGCACATTACAGTGTGAGACAG
D9S0033i 9q21.13 77747754 77748000 ATAAGTTAATGGGAATAGTTGCC CTTTCTTATAGGAACTGAAGATGC
D11S4179 11q13.5 76396260 76396495 GGATGTAAGAGTAACTGGCTCCG GAAAATGTTCTGCCTGAGGG
D1S411 1p31.1 70054757 70054960 GAGGTCAGTTGATCCAGTGG AAGGTTTCTGAGAACTTTTTGTG
D10S0554i 10p15.1 5885882 5886031 CCTGCATAAGTAATAATTTCCTTC TATCTCCTCTGAAATTAGTCACTAGTC
D9S0596i 9p21.3 23759653 23759843 ACTCCACAAATTTGTTCAATTA CAATGGTCATGAGTATTGAAAG
D1S0337i 1p34.1 44738410 44738702 GAGCTATTAGCAATGTCAGAAAAC GGCTGAGCATGAGAATCAC
D9S0793i 9q31.2 108201661 108201812 TGATAATGCTAAGGTAACTACTGTATTC GACCTCTCCTATTCCCTGC
D1S1028i 1p34.3 38575697 38576036 TGACGTGATATTTGAAATCATA CTATTGGCATTGCTAAGATTATAG
D18S0163i 18q21.31 55739924 55740399 CTTCTATGTAGCATTGTACTGGAG GAGTATTGGCCGTATTAACAA

Physical position of amplicon refers to the GRCh build 37/hg19.

Table II
Results of individual genotyping of 18 microsatellite markers for mandibular prognathism
Microsatellite Cytoband Alleles (n) Significant allele Allele frequency Fisher exact test P value Odds ratio (95% CI)
Subjects Controls 2 × 2 2 × m
D15S0154i 15q22.22 13 257 0.216 0.324 0.0000571 0.002 0.58 (0.44-0.76)
D1S1358i 1q32.2 7 92 0.362 0.465 0.000422 0.007 0.65 (0.51-0.83)
D6S0827i 6q23.2 12 236 0.057 0.115 0.000661 0.015 0.47 (0.30-0.73)
D1S0411i 1p22.3 5 285 0.165 0.247 0.000666 0.002 0.60 (0.45-0.81)
D7S0133i 7q11.22 7 295 0.183 0.113 0.000845 0.014 1.76 (1.27-2.45)
D3S0810i 3q23 2 402 0.377 0.284 0.000924 0.000924 1.53 (1.19-1.95)
D3S0830i 3p24.3 11 350 0.153 0.089 0.001 0.007 1.84 (1.28-2.64)
D4S0965i 4q28.2 7 96 0.444 0.539 0.002 0.015 0.68 (0.53-0.87)
D19S897 19q13.2 18 88 0.329 0.246 0.002 0.124 1.50 (1.16-1.94)
D9S0033i 9q21.13 13 225 0.074 0.117 0.017 0.367 0.60 (0.40-0.91)
D11S4179 11q13.5 6 235 0.274 0.214 0.018 0.044 1.39 (1.06-1.82)
D1S411 1p31.1 10 196 0.174 0.23 0.02 0.084 0.70 (0.52-0.94)
D10S0554i 10p15.1 5 145 0.057 0.093 0.028 0.084 0.59 (0.37-0.94)
D9S0596i 9p21.3 23 168 0.028 0.063 0.037 0.276 0.43 (0.20-0.94)
D1S0337i 1p34.1 6 304 0.119 0.082 0.043 0.077 1.51 (1.02-2.23)
D9S0793i 9q31.2 10 167 0.067 0.038 0.061 0.478 1.84 (0.97-3.48)
D1S1028i 1p34.3 15 337 0.058 0.086 0.084 0.318 0.65 (0.40-1.05)
D18S0163i 18q21.31 12 453 0.191 0.229 0.125 0.609 0.79 (0.59-1.06)
Only gold members can continue reading. Log In or Register to continue

Dec 19, 2018 | Posted by in Orthodontics | Comments Off on Genome-wide association study for mandibular prognathism using microsatellite and pooled DNA method
Premium Wordpress Themes by UFO Themes