Fluoride incorporation in high phosphate containing bioactive glasses and in vitroosteogenic, angiogenic and antibacterial effects

Abstract

Objectives

To manufacture and assess bioactivity of low fluoride/high phosphate (low F − /high P 2 O 5 ) bioglasses (BGs). Then the effects of BG-conditioned medium on osteoblast-like cell behavior and BG particles on bactericidal activity were investigated.

Methods

BGs (0–7% F − content, constant 6.33% P 2 O 5 in mol%) were designed and produced. BG particles was immersed in Tris Buffer solution or α-MEM to determine apatite formation and ion (Ca, P, Si and F) release. Osteoblast-like cells MC3T3-E1 were treated with BG-conditioned medium and assessed for cytotoxicity, pre-osteogenic and pro-angiogenic responses. Antibacterial ability was explored by incubating sub-gingival bacteria with BG particulates.

Results

Rapid apatite formation was observed in F − containing BGs after only 2–8 h immersion in Tris buffer solution. In the F − free group, apatite was not detectable until 72 h. Peak Ca, P and F release into Tris buffer was at 2 h immersion, and then the levels decreased. In α-MEM, apatite formation in all the BGs was undetectable until 72 h immersion. Alkaline phosphatase activity, cell number, collagen formation, bone-like mineral nodules and osteogenic gene expression of MC3T3-E1 cells were significantly promoted in low F − BG (P6.33F1) conditioned medium. MC3T3-E1 VEGF gene expression was increased, and protein production was dose-dependently promoted with F − BG-conditioned medium. After incubation with BG particulates, the growth of sub-gingival bacteria, Aggregatibacter actinomycetemcomitans and Porphyromonas gingivalis , was significantly inhibited; the antibacterial activity being dependent on the F − content of the BGs.

Significance

These results show that low F − /high P 2 O 5 BGs significantly accelerated apatite formation and promoted both pre-osteogenic and pro-angiogenic responses of MC3T3-E1 osteoblast-like cells and inhibited the growth of periodontal pathogens in vitro . These BGs may prove useful as bone graft substitutes.

Introduction

Globally, the need for bone defect repair arises due to trauma, tumor, osteoporosis and other causes of skeletal tissue loss. In dentistry, periodontitis and peri-implantitis are common diseases associated with bone loss requiring treatment. BG grafts, when exposed to body fluids, form a bone like apatite layer on their surface (a process termed ‘bioactivity’), which is capable of forming a strong bond with the living bone. For this reason they are widely utilized in dental and orthopedic applications .

Phosphate plays a vital role in BG bioactivity by forming a CaO–P 2 O 5 rich bilayer: the new surface for apatite formation . 31 P and 29 Si magic-angle-spinning nuclear magnetic resonance (MAS-NMR) spectroscopy study demonstrates that phosphate is present largely as an orthophosphate phase in BGs results in an increase of the apatite deposition rate, which potentially promotes BG bioactivity . In the design of BGs, network connectivity (NC) is considered an important factor as it represents a measure of the number of bridging oxygen atoms per network forming element and an indicator of BG solubility, reactivity and ultimately bioactivity .

In fluoride containing BGs, fluoride complexes with calcium and sodium rather than forming Si–F bonds in BG structure, this results in a decrease in the compactness of the BG network . Brauer et al. studied fluoride containing BGs by 19 F MAS-NMR and demonstrated the formation of fluorapatite (FAp, Ca 10 (PO 4 ) 6 F 2 ) , which is more acid resistant compared with hydroxyapatite (HA), has better stability and slow of degradation kinetics . Numerous in vitro and animal studies have demonstrated that fluoride can regulate bone-forming cell activities and bone resorption , such as, affecting the RANKL/OPG system directly or indirectly , regulating BMP/Smads signaling pathway or inhibiting NFATc1 gene expression to decrease osteoclastic activity . Based on the characteristics of fluoride itself and the potential of forming FAp, local delivery of fluoride could reduce demineralisation rate as well as enhancing re-mineralization to increase mineral density and clinically impact on the treatment strategies for osteoporosis . However, high levels of systemic fluoride are known to cause skeletal and dental fluorosis characterized by debilitating changes in the skeleton, and marked mottling and discoloration in the teeth . Nonetheless, the addition of fluoride into BGs and subsequent local delivery at beneficial concentrations would make such BGs more suitable than existing compounds for dental and orthopedic problems.

Grafting can fail because of insufficient vascularization deep within the body of the graft, thus angiogenesis and associated patent vascular network is crucial for optimal bone formation and subsequent bone:graft contact, ‘osseo-integration’ . Vascular endothelial growth factor (VEGF), released by osteoblastic and other cells, can promote differentiation of local mesenchymal stem cells into endothelial cells and subsequently activate the transmembrane VEFGR2 receptors in endothelial cells, which in turn activates several pathways responsible for angiogenesis . This response would be expected to encourage bone formation secondary to increased vascularization throughout the graft substitute.

Another cause of graft failure is bacterial infections which hinder the repair of bone defects . In particular, some oral pathogens associated with periodontal disease have also been associated with dental implant and defect repair failure . Fluoride is widely incorporated into dental restorative materials, to encourage FAp formation, to reduce demineralisation and enhance re-mineralization, it also has anti-microbial properties . Fluoride inhibits the dental plaque acid production that can result in demineralization . It acts directly as an enzyme inhibitor to interfere bacterial metabolism and forms metal-fluoride complexes, most commonly AlF 4− , which interact with F-ATPase and nitrogenase enzymes resulting in inhibition of bacterial activity . If fluoride released from BGs is available to influence local cell behavior, then fluoride would be a useful constituent of BGs to reduce graft failure due to inappropriate vascularization and infection.

We have created a series of BGs with high, constant phosphate content but with a varying and low fluoride addition, with a fixed BG NC. To determine whether such BGs maintained the characteristics that would make them suitable for potential use in vivo , the BGs bioactivity both in Tris buffer solution and cell culture medium were examined. Then, we further assessed the potential of BGs as modulators of biological behavior of osteoblast-like cells and bactericidal activity of the BG particles in vitro .

Materials and methods

BG synthesis

BGs in the system SiO 2 –P 2 O 5 –CaO–Na 2 O–CaF 2 ( Table 1 ) were prepared by the melt-quench route. Briefly, mixtures of analytical grade SiO 2 (Prince Minerals Ltd., Stoke-on-Trent, UK), P 2 O 5 , Na 2 CO 3 , CaCO 3 and CaF 2 (Sigma-Aldrich Company Ltd., Gillingham, UK) were weighed in the appropriate amounts to give a batch size of 200 g. The batch was mixed thoroughly and placed in a platinum/rhodium crucible, and heated at 1360 °C for 60 min in an electrically heated furnace (Lenton EHF 17/3, Hope Valley, UK). After melting, the BGs were quenched rapidly into deionized water and the resulting frit was washed with ethanol then dried in a drying cabinet at 37 °C overnight. 100 g of each BG was ground in a Gyro mill (Glen Creston, London, UK) for two sets of 7 min and sieved by a mesh analytical sieve (Endecotts Ltd., London, UK) with a size of 38 μm to obtain fine powder. The amorphous structure of the BGs was tested using powder X-ray diffraction (XRD, PANalytical, Eindhoven, The Netherlands).

Table 1
Bioglass compositions. Compositions in mol% with increasing CaF 2 content and constant P 2 O 5 . NC fixed at 2.08.
Glass SiO 2 Na 2 O CaO P 2 O 5 CaF 2
P6.33F0 38.14 29.62 25.91 6.33 0
P6.33F1 37.59 29.38 25.70 6.33 1.00
P6.33F3 36.57 28.85 25.25 6.33 3.00
P6.33F5 35.55 28.33 24.79 6.33 5.00
P6.33F7 34.53 27.81 24.33 6.33 7.00
P6.33F0 named ICSW9 in previous publications .

Ion release in Tris buffer

75 mg of each BG powder was dispersed in 50 mL Tris buffer solution, corresponding to a concentration of 1.5 g/L . All samples were placed in an orbital shaking incubator (KS 4000i Control, IKA, Staufen, Germany) at 37 °C with an agitation rate of 60 rpm for 2, 8, 24 and 72 h.

For each time point, samples of each BG were removed from the incubator and the solutions were filtered with filter paper (4–13 μm pore retention, VWR International, Lutterworth, UK). The filtered solutions were next diluted 1:10 with deionized water and 1% nitric acid and then analysed in an inductively coupled plasma-optical emission spectroscopy (ICP-OES; Varian Vista-PRO, Varian Ltd., Oxford, UK) to detect silicon, calcium, sodium, and phosphorus concentrations.

Fluoride-release into Tris buffer was measured using a fluoride-selective electrode (Orion 9609BNWP with Orion pH/ISE meter 710, both Thermo Scientific, Waltham, MA, USA).

Characterization of BG powders after immersion in Tris buffer

The filter papers collected from 2.2 were dried at 37 °C and the resultant powders were analysed using Fourier-transform infrared spectroscopy (FTIR; Spectrum GX, Perkin-Elmer, Waltham, MA, USA) data collected from 1800 to 500 cm −1 and XRD (PANalytical, Eindhoven, The Netherlands) data collected at room temperature with a 0.033° 2 θ step size and a count rate of 99.6 s step-1, from 2 θ values of 10–60°.

Cell culture and cytotoxicity of BG-conditioned medium

The mouse osteoblast-like cell line, MC3T3-E1, obtained from the Culture Collections (Public Health England, Porton Down, Salisbury, UK), was cultured under standard conditions (37 °C, 5% CO 2 /95% air, 100% humidity) in α-minimum essential medium (α-MEM, Lonza, London, UK) with 1% l -glutamine, 1% antibiotic (penicillin and streptomycin, Invitrogen, London, UK) and 5% fetal bovine serum (FBS, Lonza, London, UK).

75 mg BG particles from each group was immersed in 50 mL α-MEM with 1% antibiotic and kept shaking (60 rpm) for 2, 8, 24 and 72 h. For each time point, the samples were centrifuged (800 rpm, 5 min) to separate the solution and solid. The culture medium was then filtered with 0.2 μm pore size filters (VWR, Lutterworth, UK) for sterilization. Filtrate was further supplemented with sterile 1% l -glutamine and 5% FBS and used to treat MC3T3-E1 cells for 1, 3 and 5 days.

The cytotoxicity of BG-conditioned medium was quantified by MTT (3-[4,5-dimethylthiazol-2-yl]-2, 5 diphenyl tetrazolium bromide) assay . Briefly, medium was removed and cells were washed twice with PBS, then 30 μL 5 mg/mL tetrazolium salt MTT (Sigma-Aldrich Company Ltd., Gillingham, UK) was added to each well and incubated in 37 °C for 4 h. Formazan crystals generated by mitochondrial enzyme activity were dissolved by dimethyl sulfoxide (DMSO, Sigma-Aldrich Company Ltd., Gillingham, UK) and the intensity of purple colored reaction product quantified by measuring the absorbance spectra at 570 nm.

Ion release and apatite formation in cell culture medium

According to the cytotoxicity data, 72 h conditioned medium was chosen to detect concentrations of silicon, calcium, phosphorus, and fluoride in cell culture medium by ICP and fluoride-release was measured using a fluoride-selective electrode and the dried powders were analysed using FTIR and XRD as previously performed on BG in Tris buffer.

Total quantification of cells cultured in BG-conditioned medium

BG-conditioned medium was used to identify the effect on cell proliferation by determining the DNA quantity in cultures using the fluorochrome, bisbenzimidazole (Hoechst 33258, Sigma-Aldrich Company Ltd., Gillingham, UK) , in which increased fluorescence emission is linearly related to DNA concentration. MC3T3-E1 cells were cultured in 96-well plates in BG-conditioned medium for 7 d, 14 d and 21 d. On termination of the experiment, the cells washed in PBS, dried and lysed through a freezing and thawing cycle with 100 μL deionized water in each well to rupture cells and release DNA. The resulting lysate was then reacted with fluorochrome bisbenzimidazole (1:50) in TNE buffer with 10 mM Tris, 1 mM EDTA and 2 M NaCl (pH 7.4, Sigma-Aldrich Company Ltd., Gillingham, UK) and the resultant fluorescence intensity was measured at 460 nm emission and 355 nm excitation. Accurate cell number was determined by comparing fluorescence intensity with an established standard curve, which is a linear correction between fluorescence intensity and the cell number over a broad range (Fig. S1).

Alkaline phosphatase (ALP) activity in cells cultured in BG-conditioned medium

Cells were treated as for the cell proliferation experiments. ALP activity was measured by an enzyme histochemical assay , in which ALP converts ρ-nitrophenyl phosphate to ρ-nitrophenyl. At each time point, cells were lysed through a freezing and thawing process and reacted with a solution of 2.5 mg/mL 4-nitropheyl phosphate disodium salt hexahydrate in Tris buffer solution with 1 mM MgCl 2 (pH 9.5, Sigma-Aldrich Company Ltd., Gillingham, UK) for 40 min in 37 °C. 0.5 M NaOH was used to stop the reaction and the intensity of yellow color reaction product was quantified by measuring the absorbance at 405 nm. ALP activity of the test samples were calculated and expressed as nmol/mL/min from calibration curve .

Detection and quantification of collagen formation in BG-conditioned medium

BG-conditioned medium was further supplemented with 5 mM β-glycerophosphate and 50 μg/mL l -ascorbic acid (Sigma-Aldrich Company Ltd., Gillingham, UK) to prepare osteogenic medium.

Collagen formation was quantified by measuring the concentration of Sirius red stain incorporated in cell-mediated matrix formation . MC3T3-E1 cells were treated for 2, 3 and 4 weeks with BG-conditioned osteogenic medium. Post incubation, cells were fixed for 10 min in 2.5% glutaraldehyde at 4 °C and washed three times in deionized water. Cells were next incubated in 0.1% Sirius red F3B in a 1.3% saturated aqueous solution of picric acid (Sigma-Aldrich Company Ltd., Gillingham, UK) for 1 h at room temperature. Cultures were then washed twice with 0.5% acidified water and three times in deionized water to remove the unincorporated dye. Stained cultures were photographed followed by a dye extraction procedure using a mixture of 0.1 M NaOH and absolute methanol (1:1, Sigma-Aldrich Company Ltd., Gillingham, UK) for 30 min at room temperature. 200 μL aliquots of eluted dye were transferred to a 96-well plate and measured the absorbance at 570 nm.

Detection and quantification of mineralization in BG-conditioned medium

For the detection of bone nodule formation, at each time point, osteogenic medium was removed and cells were washed twice with PBS and fixed in 2.5% glutaraldehyde at 4 °C for 10 min. After deionized water washing 200 μL of 40 mM Alizarin Red S (pH 4.1, Sigma-Aldrich Company Ltd., Gillingham, UK) was added per well. The plates were incubated at room temperature for 40 min and washed three times with deionized water to remove unincorporated dye.

For quantification of staining, an adaptation of the protocol described by Stanford et al. was followed. Alizarin Red S was extracted from the monolayer by incubation in 10% (w/v) cetylpyridinium chloride (CPC, Sigma-Aldrich Company Ltd., Gillingham, UK) in 10 mM sodium phosphate, pH 7.0, for 30 min at room temperature. The dye was then removed and 100 μL aliquots transferred to a 96-well plate prior to absorbance reading at 570 nm.

Osteogenic gene expression in BG-conditioned medium by quantitative Reverse Transcription polymerase chain reaction (qPCR)

After treatment in BG-conditioned medium for 1, 4, 7, 14 and 21 d, total RNA of MC3T3-E1 was isolated using RNeasy mini kit (Qiagen, Manchester, UK) according to the manufacture’s protocol. RNase-Free DNase set (Qiagen, Manchester, UK) was used to eliminate DNA contamination in RNA samples. The purity of the isolated RNA was determined by measuring the optical density (OD) value (A260/A280) using the NanoDrop™ 1000 Spectrophotometer (Thermo Scientific, UK). cDNA synthesis was performed using the transcriptor first strand cDNA synthesis kit (Roche, UK) at 42 °C for 30 min, 85 °C for 5 min, 4 °C for 5 min and the products were stored in −20 °C. Quantitative RT-PCRs were carried out using the DNA Master SYBR Green I Kit (Roche Diagnostics, England, UK) in the 96-well LightCycler 480 qPCR system (Roche, UK) according to the manufacturer’s instructions. Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) was used as a housekeeping gene. The relative gene expression level was determined by comparing against the reference gene and normalized by the control group (normal medium treatment). All primers used in this study are listed in Table 2 .

Table 2
Sequences of primer pairs used for RT-PCR analysis.
Name Primers 5′–3′
GAPDH Forward ATTGTCAGCAATGCATCCTG
Reverse ATGGACTGTGGTCATGAGCC
OPN Forward GAGATTTGCTTTTGCCTGTTTG
Reverse TGAGCTGCCAGAATCAGTCACT
Col1a1 Forward CATGTTCAGCTTTGTGGACCT
Reverse GCAGCTGACTTCAGGGATGT
VEGF Forward CAGGCTGCTGTAACGATGAA
Reverse GCTTTGGTGAGGTTTGATCC

Angiogenesis gene expression and protein production in BG-conditioned medium by qPCR and Western blot

The VEGF gene expression was performed as previously described and the primers used are listed in Table 2 .

To ascertain VEGF protein production, after treatment for the indicated periods, all the cells were washed twice with cold PBS and then lysed, homogenized and sonicated in RIPA lysis buffer containing 150 mM NaCl, 1.0% NP-40, 0.5% sodium deoxycholate, 0.1% sodium dodecyl sulphate (SDS), 50 mM Tris-HCl, pH 8.0 and freshly added Protease Inhibitors (Roche, UK). Lysates were centrifuged at 16,000 × g for 20 min in 4 °C. The protein concentration was determined by DC protein assay (Bio-Rad, UK). 4× LaemmLi sample buffer (Bio-Rad, UK) was added to the lysates followed with boiling at 100 °C for 5 min and storage at −20 °C. Aliquots of the denatured proteins were separated by 10% NuPAGE ® Bis-Tris gel (Thermo Scientific, UK), transferred electrophoretically to polyvinyl difluoride (PVDF) membrane (Thermo scientific, UK) and soaked in a blocking buffer (5% non-fat milk in TBST buffer containing 20 mM Tris–HCl, pH 7.5, 0.5 M NaCl, 0.1% Tween 20) for 1 h at room temperature. Subsequently, the membrane was incubated in blocking buffer with primary antibodies overnight at 4 °C followed by three times TBST wash and secondary antibody incubation at room temperature for 1 h. Detection of protein antibody complex was performed by the ECL Western blot detection system (Thermo scientific, UK). Cyclophilin B was used as a loading control. The following antibodies were used in this study: anti-VEGF antibody (1:2000, Abcam, UK), anti-Cyclophilin B antibody (1:6000, Abcam, UK) and Goat anti-Rabbit IgG (H + L) Secondary Antibody (1:2000, Thermo scientific, UK).

Antibacterial studies

Typical sub-gingival bacteria, Aggregatibacter actinomycetemcomitans and Porphyromonas gingivalis (kindly gifted by Professor Rob Allaker, Queen Mary University of London), were grown in brain heart infusion agar plates (Fisher Scientific, Loughborough, UK) for 48 h at 37 °C under anaerobic conditions. Then the log phase cultures were harvested and the bacterial concentrations were measured by reading absorbance at 595 nm.

BG particulates were sterilized by autoclaving (dry cycle) at 121 °C for 15 min. Then both bacteria (10 6 to 10 7 CFU/mL) were cultured in brain heart infusion broth with BG particulate suspensions at concentrations of 0.625, 1.25, 2.5, 5 and 10 mg/mL or with sodium fluoride (NaF) concentrations (2, 1, 0.5, 0.25, 0.125 and 0 mM). After incubation under anaerobic conditions for 0, 2, 4 and 8 h, 10% alamarBlue (Bio-Rad, UK) was added and incubated for 1 h followed by 10 min centrifugation at 4000 rpm and 100 μL aliquots transferred to new black 96-well plates to measure fluorescent intensity at 590 nm emission and 560 nm excitation. Percent inhibition of bacterial growth was then defined as 1 − (mean fluorescence of test wells/mean fluorescence of negative control well) × 100% following the manufacturer’s instructions .

Statistical analysis

The elemental analysis was carried out with three samples per group. Cell assay data with BG-conditioned medium are presented as means ± standard errors and represent data from six replicates per experiment. qPCR and Western blot assay were performed with three samples per group and bacterial studies were four replicates. Comparisons of cell assay data were made using a one-way analysis of variance (ANOVA). Significance is indicated when P ≤ 0.05.

Materials and methods

BG synthesis

BGs in the system SiO 2 –P 2 O 5 –CaO–Na 2 O–CaF 2 ( Table 1 ) were prepared by the melt-quench route. Briefly, mixtures of analytical grade SiO 2 (Prince Minerals Ltd., Stoke-on-Trent, UK), P 2 O 5 , Na 2 CO 3 , CaCO 3 and CaF 2 (Sigma-Aldrich Company Ltd., Gillingham, UK) were weighed in the appropriate amounts to give a batch size of 200 g. The batch was mixed thoroughly and placed in a platinum/rhodium crucible, and heated at 1360 °C for 60 min in an electrically heated furnace (Lenton EHF 17/3, Hope Valley, UK). After melting, the BGs were quenched rapidly into deionized water and the resulting frit was washed with ethanol then dried in a drying cabinet at 37 °C overnight. 100 g of each BG was ground in a Gyro mill (Glen Creston, London, UK) for two sets of 7 min and sieved by a mesh analytical sieve (Endecotts Ltd., London, UK) with a size of 38 μm to obtain fine powder. The amorphous structure of the BGs was tested using powder X-ray diffraction (XRD, PANalytical, Eindhoven, The Netherlands).

Table 1
Bioglass compositions. Compositions in mol% with increasing CaF 2 content and constant P 2 O 5 . NC fixed at 2.08.
Glass SiO 2 Na 2 O CaO P 2 O 5 CaF 2
P6.33F0 38.14 29.62 25.91 6.33 0
P6.33F1 37.59 29.38 25.70 6.33 1.00
P6.33F3 36.57 28.85 25.25 6.33 3.00
P6.33F5 35.55 28.33 24.79 6.33 5.00
P6.33F7 34.53 27.81 24.33 6.33 7.00
P6.33F0 named ICSW9 in previous publications .

Ion release in Tris buffer

75 mg of each BG powder was dispersed in 50 mL Tris buffer solution, corresponding to a concentration of 1.5 g/L . All samples were placed in an orbital shaking incubator (KS 4000i Control, IKA, Staufen, Germany) at 37 °C with an agitation rate of 60 rpm for 2, 8, 24 and 72 h.

For each time point, samples of each BG were removed from the incubator and the solutions were filtered with filter paper (4–13 μm pore retention, VWR International, Lutterworth, UK). The filtered solutions were next diluted 1:10 with deionized water and 1% nitric acid and then analysed in an inductively coupled plasma-optical emission spectroscopy (ICP-OES; Varian Vista-PRO, Varian Ltd., Oxford, UK) to detect silicon, calcium, sodium, and phosphorus concentrations.

Fluoride-release into Tris buffer was measured using a fluoride-selective electrode (Orion 9609BNWP with Orion pH/ISE meter 710, both Thermo Scientific, Waltham, MA, USA).

Characterization of BG powders after immersion in Tris buffer

The filter papers collected from 2.2 were dried at 37 °C and the resultant powders were analysed using Fourier-transform infrared spectroscopy (FTIR; Spectrum GX, Perkin-Elmer, Waltham, MA, USA) data collected from 1800 to 500 cm −1 and XRD (PANalytical, Eindhoven, The Netherlands) data collected at room temperature with a 0.033° 2 θ step size and a count rate of 99.6 s step-1, from 2 θ values of 10–60°.

Cell culture and cytotoxicity of BG-conditioned medium

The mouse osteoblast-like cell line, MC3T3-E1, obtained from the Culture Collections (Public Health England, Porton Down, Salisbury, UK), was cultured under standard conditions (37 °C, 5% CO 2 /95% air, 100% humidity) in α-minimum essential medium (α-MEM, Lonza, London, UK) with 1% l -glutamine, 1% antibiotic (penicillin and streptomycin, Invitrogen, London, UK) and 5% fetal bovine serum (FBS, Lonza, London, UK).

75 mg BG particles from each group was immersed in 50 mL α-MEM with 1% antibiotic and kept shaking (60 rpm) for 2, 8, 24 and 72 h. For each time point, the samples were centrifuged (800 rpm, 5 min) to separate the solution and solid. The culture medium was then filtered with 0.2 μm pore size filters (VWR, Lutterworth, UK) for sterilization. Filtrate was further supplemented with sterile 1% l -glutamine and 5% FBS and used to treat MC3T3-E1 cells for 1, 3 and 5 days.

The cytotoxicity of BG-conditioned medium was quantified by MTT (3-[4,5-dimethylthiazol-2-yl]-2, 5 diphenyl tetrazolium bromide) assay . Briefly, medium was removed and cells were washed twice with PBS, then 30 μL 5 mg/mL tetrazolium salt MTT (Sigma-Aldrich Company Ltd., Gillingham, UK) was added to each well and incubated in 37 °C for 4 h. Formazan crystals generated by mitochondrial enzyme activity were dissolved by dimethyl sulfoxide (DMSO, Sigma-Aldrich Company Ltd., Gillingham, UK) and the intensity of purple colored reaction product quantified by measuring the absorbance spectra at 570 nm.

Ion release and apatite formation in cell culture medium

According to the cytotoxicity data, 72 h conditioned medium was chosen to detect concentrations of silicon, calcium, phosphorus, and fluoride in cell culture medium by ICP and fluoride-release was measured using a fluoride-selective electrode and the dried powders were analysed using FTIR and XRD as previously performed on BG in Tris buffer.

Total quantification of cells cultured in BG-conditioned medium

BG-conditioned medium was used to identify the effect on cell proliferation by determining the DNA quantity in cultures using the fluorochrome, bisbenzimidazole (Hoechst 33258, Sigma-Aldrich Company Ltd., Gillingham, UK) , in which increased fluorescence emission is linearly related to DNA concentration. MC3T3-E1 cells were cultured in 96-well plates in BG-conditioned medium for 7 d, 14 d and 21 d. On termination of the experiment, the cells washed in PBS, dried and lysed through a freezing and thawing cycle with 100 μL deionized water in each well to rupture cells and release DNA. The resulting lysate was then reacted with fluorochrome bisbenzimidazole (1:50) in TNE buffer with 10 mM Tris, 1 mM EDTA and 2 M NaCl (pH 7.4, Sigma-Aldrich Company Ltd., Gillingham, UK) and the resultant fluorescence intensity was measured at 460 nm emission and 355 nm excitation. Accurate cell number was determined by comparing fluorescence intensity with an established standard curve, which is a linear correction between fluorescence intensity and the cell number over a broad range (Fig. S1).

Alkaline phosphatase (ALP) activity in cells cultured in BG-conditioned medium

Cells were treated as for the cell proliferation experiments. ALP activity was measured by an enzyme histochemical assay , in which ALP converts ρ-nitrophenyl phosphate to ρ-nitrophenyl. At each time point, cells were lysed through a freezing and thawing process and reacted with a solution of 2.5 mg/mL 4-nitropheyl phosphate disodium salt hexahydrate in Tris buffer solution with 1 mM MgCl 2 (pH 9.5, Sigma-Aldrich Company Ltd., Gillingham, UK) for 40 min in 37 °C. 0.5 M NaOH was used to stop the reaction and the intensity of yellow color reaction product was quantified by measuring the absorbance at 405 nm. ALP activity of the test samples were calculated and expressed as nmol/mL/min from calibration curve .

Detection and quantification of collagen formation in BG-conditioned medium

BG-conditioned medium was further supplemented with 5 mM β-glycerophosphate and 50 μg/mL l -ascorbic acid (Sigma-Aldrich Company Ltd., Gillingham, UK) to prepare osteogenic medium.

Collagen formation was quantified by measuring the concentration of Sirius red stain incorporated in cell-mediated matrix formation . MC3T3-E1 cells were treated for 2, 3 and 4 weeks with BG-conditioned osteogenic medium. Post incubation, cells were fixed for 10 min in 2.5% glutaraldehyde at 4 °C and washed three times in deionized water. Cells were next incubated in 0.1% Sirius red F3B in a 1.3% saturated aqueous solution of picric acid (Sigma-Aldrich Company Ltd., Gillingham, UK) for 1 h at room temperature. Cultures were then washed twice with 0.5% acidified water and three times in deionized water to remove the unincorporated dye. Stained cultures were photographed followed by a dye extraction procedure using a mixture of 0.1 M NaOH and absolute methanol (1:1, Sigma-Aldrich Company Ltd., Gillingham, UK) for 30 min at room temperature. 200 μL aliquots of eluted dye were transferred to a 96-well plate and measured the absorbance at 570 nm.

Detection and quantification of mineralization in BG-conditioned medium

For the detection of bone nodule formation, at each time point, osteogenic medium was removed and cells were washed twice with PBS and fixed in 2.5% glutaraldehyde at 4 °C for 10 min. After deionized water washing 200 μL of 40 mM Alizarin Red S (pH 4.1, Sigma-Aldrich Company Ltd., Gillingham, UK) was added per well. The plates were incubated at room temperature for 40 min and washed three times with deionized water to remove unincorporated dye.

For quantification of staining, an adaptation of the protocol described by Stanford et al. was followed. Alizarin Red S was extracted from the monolayer by incubation in 10% (w/v) cetylpyridinium chloride (CPC, Sigma-Aldrich Company Ltd., Gillingham, UK) in 10 mM sodium phosphate, pH 7.0, for 30 min at room temperature. The dye was then removed and 100 μL aliquots transferred to a 96-well plate prior to absorbance reading at 570 nm.

Osteogenic gene expression in BG-conditioned medium by quantitative Reverse Transcription polymerase chain reaction (qPCR)

After treatment in BG-conditioned medium for 1, 4, 7, 14 and 21 d, total RNA of MC3T3-E1 was isolated using RNeasy mini kit (Qiagen, Manchester, UK) according to the manufacture’s protocol. RNase-Free DNase set (Qiagen, Manchester, UK) was used to eliminate DNA contamination in RNA samples. The purity of the isolated RNA was determined by measuring the optical density (OD) value (A260/A280) using the NanoDrop™ 1000 Spectrophotometer (Thermo Scientific, UK). cDNA synthesis was performed using the transcriptor first strand cDNA synthesis kit (Roche, UK) at 42 °C for 30 min, 85 °C for 5 min, 4 °C for 5 min and the products were stored in −20 °C. Quantitative RT-PCRs were carried out using the DNA Master SYBR Green I Kit (Roche Diagnostics, England, UK) in the 96-well LightCycler 480 qPCR system (Roche, UK) according to the manufacturer’s instructions. Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) was used as a housekeeping gene. The relative gene expression level was determined by comparing against the reference gene and normalized by the control group (normal medium treatment). All primers used in this study are listed in Table 2 .

Nov 23, 2017 | Posted by in Dental Materials | Comments Off on Fluoride incorporation in high phosphate containing bioactive glasses and in vitroosteogenic, angiogenic and antibacterial effects

VIDEdental - Online dental courses

Get VIDEdental app for watching clinical videos