Effects of lactoferrin on bone resorption of midpalatal suture during rapid expansion in rats

Introduction

The aim of this study was to investigate the effect of lactoferrin (LF) on bone resorption of rats’ midpalatal sutures during rapid palatal expansion.

Methods

Sixty male 5-week-old Wistar rats were randomly divided into 3 groups: expansion only (EO), expansion plus LF (E + LF), and sham device (control).

Results

Microcomputed tomography showed that the bone volume/tissue volume ratio and the relative bone mineral density of the suture bone were significantly increased in the E + LF group compared with the EO group. Histochemical staining suggested that the activity of osteoblast-like cells and the amount of new bone formation were stimulated in the E + LF group whereas the activity of osteoclasts showed no obvious difference between groups. On the other hand, the immunohistochemical and the real-time polymerase chain reaction results showed that the expressions of receptor activator of nuclear factor kappa B ligand and osteoprotegerin had no significant difference between the EO and E + LF groups.

Conclusions

These findings demonstrated that LF could stimulate bone volume and bone density in midpalatal sutures during the suture remodeling process under tensile force. However, this enhancement effect was not caused by the reduction of bone resorption.

Highlights

  • •

    Lactoferrin does not inhibit osteoclastogenesis in the midpalatal suture during RPE.

  • •

    Lactoferrin does not inhibit osteoclast-induced bone resorption during RPE.

  • •

    Lactoferrin could prevent relative bone mineral density from declining during RPE.

  • •

    Lactoferrin may improve the stability of maxillary expansion by promoting osteogenesis.

Rapid palatal expansion (RPE) is a widely used approach to correct transverse maxillary deficiency. Stretching of the sutures induces a biologic chain of events that leads to new bone deposition in the midpalatal suture. During the procedure, the suture undergoes remodeling, which includes bone resorption and formation and fiber rearrangement. The suture remodeling continues until the architectural environment achieves equilibrium. Although the midpalatal suture can be successfully expanded, relapse has often been reported. A major reason for early relapse is inadequate bone formation in the suture. Therefore, enhancing bone formation and inhibiting bone resorption in the midpalatal suture may improve the stability of RPE.

Lactoferrin (LF) is an iron-binding glycoprotein that belongs to the transferrin family with pleiotropic functions including antimicrobial and immunomodulatory activities. LF is present in high concentrations in colostrum and milk and circulates at concentrations of 2 to 7 * 10 −6 g per milliliter in the human body. Recently, there has been growing interest in the potential use of LF for the improvement of bone metabolism. Investigations have shown that LF could not only induce proliferation of primary osteoblasts, increase osteoblast differentiation, and protect osteoblastic cells from apoptosis, but also potently inhibit osteoclastogenesis, thus reducing the number of cells that can actively resorb bone. The numbers of newly developed osteoclasts in mouse bone marrow cultures, assessed as multinucleated cells staining positive for tartrate-resistant acid phosphatase, were significantly decreased due to LF at concentrations of 10 μg per milliliter; at 100 μg per milliliter, osteoclastogenesis was completely arrested. Taken together, LF might cause an overall increase in bone mass by promoting bone formation and inhibiting bone resorption.

Receptor activator of nuclear factor kappa B ligand (RANKL), receptor activator of nuclear factor kappa B (RANK), and osteoprotegerin (OPG) system is a critical signal transduction pathway that regulates osteoclastogenesis. RANKL is a new tumor necrosis factor-family molecule that is preferentially expressed on the cell membrane of committed preosteoblastic cells, whereas its specific receptor, RANK, is expressed in osteoclast progenitors. RANKL and RANK bind with each other through cell-to-cell contact between preosteoblasts and osteoclast progenitors, and subsequently activate osteoclastogenesis. The interaction between RANKL and RANK is regulated by OPG, a decoy receptor for RANKL also produced by osteoblast cells, which binds with RANKL competitively and blocks RANKL-RANK signaling; therefore, it inhibits osteoclastogenesis. Previous studies have shown that RANKL is a key osteoclast differentiation factor required for osteoclast development and bone remodeling in vivo, and the biologic effects of OPG on bone cells include the inhibition of terminal stages of osteoclast differentiation, suppression of the activation of mature osteoclasts, and induction of their apoptosis. The balance of the counteraction between RANKL and OPG regulates the development and activation of osteoclasts and bone metabolism. Therefore, the ratio of RANKL and OPG is determined to regulate osteoclast activity and bone metabolism.

Therefore, we supposed that LF might inhibit osteoclastogenesis in vivo, and the critical signaling pathway regulating osteoclastogenesis—the OPG/RANK/RANKL system—plays an important role in this process. The main purpose of this study was to investigate the effect of LF on bone resorption during midpalatal suture remodeling under tensile force.

Material and methods

Sixty 5-week-old male Wistar rats weighing 100 ± 10 g were obtained from the experimental animal center at Sichuan University, Chengdu, China. The rats were fed the same ground diet with fresh drinking water, and their health was checked daily. All study procedures were approved by the institutional animal care and use committee of Sichuan University.

The animals were randomly divided into 3 groups of 20 animals each: expansion only (EO), expansion plus LF (E + LF), and sham device (control). The rats in the EO and E + LF groups were subjected to rapid mechanical expansion, and those in the control group received expansion devices separated at the middle (no activation) ( Fig 1 , A ). An expansion spring with 2 helices was fabricated with 0.014-in orthodontic wire (supreme type; AJ Wilcock Australian Wire, Birmingham, United Kingdom). The initial expansion force was calibrated to 50 ± 5 g. The spring was fitted between the maxillary right and left molars and secured by Transbond LR light-cured resin (3M Unitek, Monrovia, Calif) ( Fig 1 , B ). The animals were under anesthesia with a combination of ketamine (87 mg/kg) and xylazine (13 mg/kg) during setting of the appliances. The fit was checked daily; in the EO and E + LF groups, the appliances were activated immediately after bonding. No reactivation was performed during the experimental period. Animals in the E + LF group were gavage-fed daily with 1 mg per 100 g of body weight of LF (95%; Westland Milk Products, Hokitika, New Zealand) dissolved in saline solution at a concentration of 1000 μg per milliliter. The nimals in the other 2 groups received the same volume of vehicle (saline solution). Five animals from each group were randomly selected and killed 1, 4, 7, and 14 days after bonding of the spring.

Fig 1
Mechanical expansion devices used in this study: A, the expansion devices applied in the EO and E + LF groups (before activation) and control group (separated at the middle); B, intraoral view of the expansion device in the rat.

The maxilla including the midpalatal suture of each animal was dissected. For microcomputed tomography (μCT) evaluation, the specimens were fixed in 4% paraformaldehyde buffer for 48 hours at 4°C. For histochemical and immunohistochemistry staining, fixed tissue sections were decalcified in neutral 10% ethylene diamine tetra-acetic acid at room temperature for at least 4 weeks. After dehydration and paraffin embedding, 3-μm serial sections in a direction vertical to the long axis of the midpalatal suture near the first molars were cut on a microtome (HM 355S; Microm International, Walldorf, Germany) and mounted on glass slides. For real-time polymerase chain reaction, the mucoperiosteum was wiped off, and the bilateral bone 1 mm aside the suture in the first molar region was dissected rapidly. Then the specimen, with approximately 1/10 suture tissue and 9/10 palatal bone, was put into the liquid nitrogen instantly.

The maxillae were scanned using the high resolution μCT 50 system (Scanco Medical, Brüttisellen, Switzerland) with a voxel resolution of 10 μm. Passing through a 3-dimensional Gaussian filter (mean, 1.2; filter support, 1), the 3-dimensional stacks of images were then analyzed using VG Studio Max software (version 2.2; Volume Graphics, Heidelberg, Germany).

The midpalatal suture region was defined as our region of interest, which started from the midpalatal bony edges and extended bilaterally on each side for 200 μm with anterior and posterior boundaries at the apical foramen of the mesial and distal root of the first molars ( Fig 2 , A ). The volume of the region of interest was 1.5 mm 3 on average and about 3/4 of it was palatal bone. The width of the suture was measured by tracing the bilateral bone surface of the midpalatal suture using the Thickness Analysis tools of the VG Studio Max software ( Fig 2 , B ). Maxilla width was obtained by measuring the width of palatal bones at 3 levels: mesial root, distal root, and central buccal root of the first molars ( Fig 2 , C-H ). Moreover, the bone volume/tissue volume ratio and the mean gray scale of the region of interest were also measured. Then the relative bone mineral density was calculated as the value of individual mean gray scale of each animal in the EO and E + LF groups divided by the average mean gray scale of the control group at corresponding time points.

Fig 2
Analyses with μCT: A, region of interest was indicated (enclosed in the solid line ) on μCT images in the transverse and coronal planes; B, suture width was measured by tracing the bilateral bone surface of the midpalatal suture; sections were made along the lines at 3 levels: C and D ; mesial root; E and F, distal root; and G and H, central buccal root of the first molar.

For morphologic examination, several sections were stained with hematoxylin and eosin. These sections were observed under a microscope (ECLIPSEE200; Nikon Instruments, Melville, NY) and a digital camera system (Penguin 600CL CCD; Pixera, San Jose, Calif), and microphotographs were taken.

For the immunohistochemistry staining of RANKL, OPG, and cathepsin k, tissue sections were placed in 3% hydrogen peroxide for 30 minutes in the dark. Subsequently, sections were blocked in blocking solution containing 4% bovine serum albumin. Then sections were incubated with polyclonal primary antibodies diluted in blocking solution with different dilution rates: RANKL (ab62516), 1:400; OPG (ab73400), 1:200; and cathepsin k (ab19027), 1:500, at 4°C overnight in a humidified chamber. The slides were then incubated for 30 minutes with antirabbit immunoglobulin (ZSGB-Bio; Beijing, China) diluted 1:100 in phosphate-buffered saline solution as secondary antibody. After they were rinsed, the tissue sections were stained in a 3, 3′-diaminobenzidine solution for about 30 seconds. To prove the specificity of the immunoreactions, negative controls were carried out by omitting the primary antibody. The immunoreactivities of RANKL and OPG was evaluated using Image J software (National Institutes of Health, Bethesda, Md), and the immunoreactive intensity was converted to positive cytoplasm staining area/observation area ratio. Cathepsin k was used as the marker for osteoclasts; its positive cell number in the midpalatal suture region with the same area was calculated in every slide and subjected to statistical analysis.

The immunohistochemistry slides were examined twice at a 2-week interval by an examiner (Y.C.) with standardized training. All measurements were done using the single-blind method.

Total ribonucleic acid (RNA) was extracted using the total RNA extraction kit (Bioer Technology, Hangzhou, China) based on manufacturer’s protocol. After detecting the RNA concentration and purity, the samples were subjected to reverse transcription using the SYBR PrimeScript RT-PCR Kit (TaKaRa, Dalian, Japan) according to the manufacturer’s protocol. Each real-time polymerase chain reaciton was conducted in triplicate in an ABIPRISM 7300 real-time polymerase chain reaction system (Applied Biosystems, Foster City, Calif). Primers used for real-time polymerase chain reaction analysis are given in the Table . The comparative computed tomography method and the arithmetic formula 2-ΔΔCT were used to obtain and calculate the results.

Table
Gene nomenclature, primer sequences, and predicted sizes of the amplified products for the genes studied
Gene Primer Sequence (5′-3′)
RANKL Forward Primer GGGGAGCACTAAGAACTGGTCA
Reverse Primer GTTGGACACCTGGACGCTAAT
OPG Forward Primer TGGAATAGATGTCACCCTGTGC
Reverse Primer GCTGTGTCTCCGTTTTSTCCTCTC
RATACTIN Forward Primer ACGGTCAGGTCATCACTATACG
Reverse Primer GGCATAGAGGTCTTTACGGATG

Statistical analysis

The data were processed with software (version 11.5; SPSS, Chicago, Ill). The results were expressed as means ± standard deviations. The data of the μCT, cell counts, OPG and RANKL immunoreactivity, and messenger ribonucleic acid (mRNA) expression level were compared across time in the same group and between groups at the same time point using 1-way analysis of variance and Tukey post hoc tests. The significance level was set at P <0.05. The consistency of 2 immunohistochemistry measurements by 1 examiner (Y.C.) was tested by calculating the intraclass correlation coefficient.

Results

The expansion appliance was well tolerated by the rats, and the average weight of each group was slightly decreased on day 1 and had recovered by day 4. There were no significant differences in mean body weight among the groups during the experiment.

The maxilla width increased as the rapid mechanical expansion progressed and was significantly greater in the EO and E + LF groups than in the control group. No difference of maxilla width was observed in the 2 expansion groups ( Fig 3 , A ).

Fig 3
Comparative analyses of the μCT measurements: A, maxilla width increased with time and was significantly greater in the 2 expansion groups than in the control group; B, decrease of suture width indicated new bone formation in the midpalatal suture area in both EO and E + LF groups after day 7. Since the suture was significantly narrower in the E + LF group after expansion, it shows that more bone filled in the suture gap, reducing the suture width. C , Bone volume/tissue volume ( BV/TV ) ratio and D, relative bone mineral density ( RBMD ) both showed significant declines in the EO group from day 7. Bars indicate standard deviations.

In the control group, a small increase of suture width was observed after day 7. Compared with the control group, suture widths in the EO and E + LF groups significantly increased on day 4. However, widths were significantly reduced from day 7. Suture width was significantly smaller in the E + LF group compared with the EO group on days 7 and 14 ( Fig 3 , B ).

Bone regeneration in the midpalatal suture was detected by changes of bone volume/tissue volume ratio and relative bone mineral density at the region of interest. The bone volume/tissue volume ratio in the region of interest significantly declined in the EO group on day 7 and then increased on day 14, but was still lower than that in the other 2 groups, with no significant difference between the control and E + LF groups ( Fig 3 , C ). Simultaneously, a similar trend was observed in relative bone mineral density in the identical region of interest. The relative bone mineral density in the EO group decreased on day 7, was significantly lower than in the E + LF group, and rose but was still lower than in the E + LF group on day 14 ( Fig 3 , D ).

Under histologic observation, the structure of the nonexpansion midpalatal suture consisted of 2 masses of chondrocytes covering the edges of palatal bone with a thin layer of fibrous tissue separating them. The periosteal cell layers covering the oral and nasal sides of the palatal bones were thicker in the region of the midpalatal suture ( Fig 4 , A-E ). In the EO and E + LF groups, upon expansion, significant tissue remodeling was observed. On day 1, the bilateral chondrocyte layers were forced apart laterally, collagen fibers reoriented across the suture, and periosteal cells migrated into the suture ( Fig 4 , F ). On day 4, osteoblast-like cells began to accumulate in the suture area ( Fig 4 , G ). Then pink osteoid and new bone formation were identified at the edges of the palatal bone on day 7 ( Fig 4 , H ). At the late stage of the experiment, the former layered structure began reconstruction as bone marrow cavities extended to the palatal bone surface and cellular fibrous tissues filled in the suture ( Fig 4 , I ). In the E + LF group, the histologic reaction was similar to that in the EO group. However, compared with the EO group, periosteal cells migrating into the suture increased, the amounts of osteoid and new bone formation were greater in the E + LF group, and there were more osteoblast-like cells in the palatal suture area in the E + LF group throughout the experiment ( Fig 4 , J-M ).

Dec 10, 2018 | Posted by in Orthodontics | Comments Off on Effects of lactoferrin on bone resorption of midpalatal suture during rapid expansion in rats

VIDEdental - Online dental courses

Get VIDEdental app for watching clinical videos