Cancer genes alterations and HPV infection in oral squamous cell carcinoma

Abstract

The aim of this study was to gain a better understanding of cancer genes contributing to oral squamous cell (OSCC) development and progression and correlate genetic changes to clinical parameters. Human papilloma virus (HPV) 16 detection is also included in the study. 60 samples of OSCC were analysed for c-erbB2 and c-myc amplification by dPCR, H-ras and p53 point mutations by PCR/SSCP. HPV was detected via amplification of its E1 and E6 genes. c-erbB2 was altered in 45%, c-myc in 35%, H-ras in 22% and p53 in 60% of samples. HPV was detected in 10% of cases. The frequency of p53 gene mutations showed a statistically significant association with tumour stage. Patients with c-erbB2 and H-ras alterations had lower survival than patients without these alterations. The number of detected genetic changes was remarkable but statistical association with tumour natural history was poor, indicating high clonal heterogeneity and multiple pathways of carcinogenesis.

Head and neck squamous cell carcinoma (HNSCC) is the sixth most common human cancer in developed countries, and 50% of all HNSCCs occur in the oral cavity . Despite advances in therapeutic protocols and prevention, the 5-year survival rate is poor (about 50%). This is mainly because the negligible symptoms of the initial disease phase are often overlooked and when patients present they already have local metastasis . Predicting tumour behaviour and adequate therapy is also a problem. HNSCCs demonstrate marked heterogeneity, so tumours that belong to the same histopathological grade may have different natural history and clinical evolution. Markers that could determine individual tumour properties and predict behaviour are needed.

The impact of numerous genetic alterations underlying the development and progression of oral squamous cell carcinoma (OSCC) are not completely understood. OSCC arises from an accumulation of molecular lesions in two major classes of genes: tumour suppressor genes (TSG), which promote tumour development when inactivated and oncogenes, which promote tumour development when activated. Most activated oncogenes initiate cellular growth, but inactivated TSGs lose control over the cell cycle. The uncontrolled growth signal for proliferation may be induced by different members of the signal transduction pathway, such as growth factors and/or their receptors, cytoplasmic protein kinases and nuclear transcription factors. c-erbB2/H-ras/c-myc is a commonly activated pathway.

c-erbB2 plays an important role in the pathogenesis of various solid tumours including OSCC. Usually, mutations resulting in gene amplification and oncoprotein overexpression have a major role in malignant transformation . H-ras gene is functionally related to c-erbB2, it is typically activated by point mutation in codons 12, 13 and 61. The product of H-ras gene-p21, transmits mitogenic signals via Raf/MAPK signaling casacades to various transcription factors . One of the most important transcription factors, involved in the regulation of expression of 10–15% of mammalian genes is the product of c-myc oncogene . By transactivation of numerous genes (e.g. cyclins, cdks), c-myc has an important role in the regulation of basic cellular processes, such as stimulation of cell division, inhibition of terminal differentiation and activation of apoptosis . The oncogenic potential of c-myc is achieved by gene amplification and/or overexpression of the oncoprotein. Oncogene activation of c-erbB2/H-ras/c-myc genes may generate mitogenic signal, but will not lead to neoplastic transformation if cells contain normal TSGs. p53 is the most important TSG because its product, the p53 protein, maintains the stability of the genome by transactivating genes involved in growth arrest, DNA repair and apoptosis . Normal p53, through cyclin kinase inhibitors, arrests the cell cycle if the DNA is damaged, until the damage is repaired. If the lesions are severe, p53 prevents their accumulation by inducing apoptosis. Tumour cells lacking normal p53 do not arrest in G1 nor undergo apoptosis. The p53 protein can also be disabled by binding to proteins of the human papilloma virus (HPV). Among high-risk HPV types, HPV16 is recognized as one of the possible factors in the development of oral carcinoma . Although not universally accepted, evidence supports two aetiopathological mechanisms underlying the development and progression of OSCC: HPV-positive and HPV-negative pathways. HPV, after its integration in the host genome, through expression of viral oncoproteins E6 and E7 can be involved in oral pathogenesis (HPV + way) . E6 and E7 oncoproteins induce cellular transformation and deregulation of the cell cycle, by inactivating p53 and Rb protein. When different carcinogenic factors (e.g. tobacco smoke, alcohol) are involved in oral carcinogenesis and a high frequency of mutations in oncogenes and TSGs are found, HPV is not required for malignant transformation (HPV − way) .

The aim of this study is to determine the frequency of mutations in c-erbB2, H-ras, c-myc oncogenes and p53 TSG in OSCC in the Serbian population and to establish a possible association between these molecular changes and clinico-histopathological parameters, including 5-year survival. The role of HPV in the pathogenesis of oral cancer is also evaluated.

Materials and methods

Patients

60 formalin-fixed, paraffin-embedded samples of OSCC, from patients who underwent surgery between 2000 and 2001 were analysed. Tissue specimens were collected according to the requirements of the Ethical Committee of the School of Dentistry, Belgrade, following signed informed consent being obtained from the patients. Malignant tissue was carefully separated from surrounding normal tissue by microdissection under optical microscopy. Tumour stage was defined according to the TNM classification of the International Union Against Cancer. Histological grading was assessed according to the World Health Organization classification . All data regarding the patients are summarized in Table 1 .

Table 1
Distribution of OSCCs with mutations in p53, c-erbB2, H-ras and c-myc genes according to clinico-pathological data.
Clinicopatological features No. p53 p c-erbB2 p H-ras p c-myc p
60 36 19 13 21
Grade
G1 7 2 1 2 2
G2 31 22 0.09 10 0.62 5 0.59 12 0.92
G3 22 12 8 6 7
Tumour stage
T1 3 1 0 0.85 1 0.45 1
T2 24 14 0.04 a 8 3 9 0.50
T3 26 14 0.02 b 9 7 7
T4 7 7 2 2 4
Lymph node
N0-negative 49 29 0.78 15 0.72 9 0.23 19 0.29
N1-positive 11 7 4 4 2
Origin of tumour
Primary 45 28 0.54 13 0.42 12 0.15 17 0.54
Recurrence 15 8 6 1 4
Age (years)
<60 27 15 0.52 7 0.38 3 0.11 6 0.06
>60 33 21 12 10 15
Gender
Male 47 27 0.53 17 0.19 10 0.89 15 0.34
Female 13 9 2 3 6
Smoking
− 37 20 0.23 5 <0.001 7 0.42 12 0.59
+ 23 16 14 6 9

No., number of patients; p , group statistics.

a T2 vs. T4.

b T3 vs. T4.

DNA extraction

DNA was extracted from formalin-fixed, paraffin-embedded samples. Deparaffinization was carried out by two successive immersions in xylene and in absolute ethanol. After deparaffinization, the tissue was digested overnight at 37 °C in a digestion buffer containing 100 mM NaCl, 10 mM Tris–HCl (pH 8.0), 25 mM ethylenediamine tetraacetic acid (EDTA), 10% sodium dodecylsulfate (SDS) and 20 μl of 10 mg/ml proteinase K. DNA extraction was performed using the phenol/chloroform/isoamyl alcohol procedure, followed by precipitation in absolute ethanol/0.3 M sodium acetate. The obtained DNA was washed in 70% ethanol, dried and resuspended in dH 2 O. The concentration of DNA was measured spectrophotometrically.

Polymerase chain reaction-single strand conformation polymorphism (PCR-SSCP)

60 OSCCs were analysed for the presence of the most common point mutations in H-ras (codons 12, 13 and 61) and p53 (exons 5–8) genes. Mutation screening of H-ras and p53 was done using PCR amplification followed by SSCP. PCR reactions were performed in a volume of 25 μl reaction mixture containing 300 ng of genomic DNA, 2.5 μl Taq buffer (10 × PCR buffer II), 2 μl M g Cl 2 (25 mM), 0.5 μl deoxyribonucleoside triphosphate (dNTP) mix (10 mM PCR nucleotide mix), 0.5 μl (100 ng/μl) of each primer, 1 U Taq polymerase (Fermentas, Vilnius, Lithuania). PCR conditions for p53 and H-ras amplifications involved a 3 min initial denaturation step at 94 °C, followed by 35 cycles at 94 °C (1 min), 60 °C (exon 5 and 6)/64 °C (exon 7)/58 °C (exon 8) for 1 min/56 °C (H-ras 61)/50 °C (H-ras 12-13) for 45 s, 72 °C (1 min), and final extension at 72 °C (7 min), on a PCR thermal cycler (PCR Express, Hybaid, Corp. USA). The primers used for PCR were as follows:

p53 exon 5, forward 3′ TTCCTCTTCCTACAGTACTC 5′ and

reverse 5′ GCAAATTTCCTTCCACTCGG 3′;

exon 6, forward 5′ ACCATGAGCGCTGCTCAGAT 3′ and

reverse 5′ AGTTGCAAACCAGACCTCAG 3′;

exon 7, forward 5′ CAAGTGGCTCCTGACCTGGA 3′ and

reverse 5′ GTGTTATCTCCTAGGTTGGC 3′;

exon 8, forward 5′ CCTATCCTGAGTAGTGGTAA 3′ and

reverse 5′ CCAAGACTTAGTACCTGAAG 3′;

H-ras (codon 12–13), forward 5′ ATGACGGAATATAAGCTGGT 3′ and

reverse 5′ CGCCAGGCTCACCTCTATA 3′.

H-ras (codon 61), forward 5′ AGGAAGCCCTCCCCGGTGGCG 3′, and

reverse 5′AGGTGGTCATTGATGGGGAG 3′.

The amplified products of 325 base pair (bp) (exon 5), 230 bp (exon 6), 139 bp (exon 7), 330 bp (exon 8), 109 bp (H-ras 61) and 123 bp (H-ras 12-13) were subjected to 8% polyacrylamide gel electrophoresis and visualized by ethidium bromide staining.

For SSCP analysis, 7 μl of PCR product were mixed with 10 μl of loading dye (95% formamide, 20 mM EDTA, 0.05 xylene cyanol, 0.05% bromophenol blue). The samples were heated to 96 °C for 6 min in the thermal cycler, rapidly cooled on ice and loaded onto 10–12% nondenaturating polyacrylamide gel (24 cm × 15 cm × 0.2 cm). Electrophoresis was carried out at 400–700 V for 6 h at +4 °C in 0.5–1 XTris-Borate-EDTA (XTBE). Gels were stained with 1% AgNO 3 . The presence of band mobility shift was indicative of mutation. A PCR product obtained with DNA extracted from the blood of a healthy person was used as a negative control. To maximize the accuracy, each sample was tested at least twice by separated PCR reactions and SSCP runs. In order to confirm the results of PCR-SSCP, DNA samples were sequenced commercially.

Differential polymerase chain reaction (dPCR)

The c-erbB2 and c-myc amplification were determined using dPCR. This method was performed by co-amplification of target genes (c-erbB2/c-myc), and a control gene ‘single copy gene’ (dopamine receptor gene-D2R) . Duplex PCR mixtures consisted of: 0.5 μl of two sets of primers of the same concentration (100 ng/μl), 300 ng genomic DNA, 2 μl dNTPs mix (10 mM PCR nucleotide mix), 4 μl M g Cl 2 (25 mM), 2.5 μl Taq buffer (10 × PCR buffer II) and 1 U Taq polymerase (Fermentas, Vilnius, Lithuania). PCR reactions were as follows: initial denaturation 95 °C for 3 min, followed by 30 cycles at 95 °C for 1 min, 50 °C (c-myc)/55 °C (c-erbB2) for 1 min, 72 °C for 1 min, and final extension at 72 °C for 7 min. Primer sequences were:

c-myc: forward 5′ GCTCCAAGACGTTGTGTGTTCG 3′ and

reverse 5′ GGAAGGACTATCCTGCTGCCAA 3′;

c-erbB2: forward 5′ CCTCTGACGTCCATCATCT 3′and

reverse 5′ ATCTTCTGCTGCCGTCGTT 3′;

for D2R: forward 5′ CCACTGAATCTGTCCTGGTATG 3′and

reverse 5′ GTGTGGCATAGTAGTTGTAGTGG 3′. Two pairs of primers generated c-erbB2/D2R and c-myc/D2R products of 98/112 and 158/112 bp, respectively. The PCR products were separated on 10% polyacrylamide gel, stained with 1% AgNO 3 solution, and the intensity of the co-amplified bands was assessed using Scion image software program. The ratio of intensity of c-erbB2/D2R and c-myc/D2R bands was used for semi-quantitative estimation of gene amplification. A ratio higher than 1 may be interpreted as amplification, but the software (Scion image) considered only pixel increase superior to 1.25 as indicative of amplification . In some samples the intensity of the control band was significantly higher than the corresponding oncogene band, and that was characterized as gene deletion. Each sample was tested by two dPCRs at least.

HPV identification in OSCC

Using universal primers, samples were analysed by amplification of the highly conserved E1 region of the HPV genome. HPV/E1 positive specimens were subjected to second amplifications to confirm the presence of the E6 region of HPV16 by using type-specific primers . PCR conditions for HPV/E1 were: initial denaturation at 95 °C (3 min), followed by 40 cycles comprising denaturation at 94 °C (1 min), annealing at 40 °C (2 min), and elongation at 72 °C (90 s); and for HPV/E6: initial denaturation at 95 °C (3 min), followed by 35 cycles each consisting of denaturation at 94 °C (1 min), annealing at 55 °C (1 min), and elongation at 72 °C (1 min). Primer sequences were:

HPV/E1: forward 5′ TGGTACAATGGGCATATGAT 3′ and

reverse 5′ ATAATGGCTTTTGGAATTTACA 3′;

for HPV/E6: forward 5′ TCAAAAGCCACTGTGTCCTG 3′ and

reverse 5′ CGTGTTCTTGATGATCTGCA 3′. The lengths of HPV/E1 and HPV16/E6 amplicons were 444 bp and 120 bp, respectively.

Statistical analysis

Fisher’s exact and χ 2 tests were performed in association studies. 5-year survival estimation was carried out by Kaplan–Meier analysis. Differences in the curves were evaluated by log-rank test. Statistical significance was set at p < 0.05.

Only gold members can continue reading. Log In or Register to continue

Stay updated, free dental videos. Join our Telegram channel

Feb 8, 2018 | Posted by in Oral and Maxillofacial Surgery | Comments Off on Cancer genes alterations and HPV infection in oral squamous cell carcinoma

VIDEdental - Online dental courses

Get VIDEdental app for watching clinical videos