Introduction
Accelerating orthodontic treatment with vibratory forces was introduced in the last decade, but gained little popularity because of increased costs and questionable results. Although systematic reviews report mixed outcomes, research hasn’t focused on molecular-level changes. The Hippo pathway, a conserved mechanism controlling organ size via cellular proliferation and apoptosis, may be involved. This study assesses whether vibratory forces activate the Hippo pathway in cultured periodontal ligament fibroblasts.
Methods
Periodontal ligament cells were scraped after the atraumatic extraction of the premolar tooth, and periodontal ligament fibroblast cells were cultured. The cells were subjected to low, medium, high, and very high vibratory settings (50, 100, 150, and 200 Hz, respectively) using a vibrator for 20 minutes at 0, 24, and 48 hours. Real-time–qualitative polymerase chain reaction (RT-qPCR) and gel electrophoresis evaluated actin-vimentin expression. Hippo pathway regulators—MST1, LATS, YAP, and TAZ—were analyzed via RT-qPCR and western blot.
Results
Cultured cell viability declined as the force increased from 50 to 200 Hz. RT-qPCR showed that MST1 and LATS mRNA levels rose with force, whereas YAP and TAZ were downregulated. Western blotting revealed increased MST1 and LATS proteins, with YAP and TAZ levels remaining low after vibration. Vimentin mRNA increased with force; actin peaked at 100 Hz, then declined.
Conclusions
The results show activation of cytoprotection via the Hippo pathway ON phase, shielding periodontal ligament cells from trauma when exposed to jiggling forces. This partly explains why external vibration forces don’t speed up orthodontic tooth movement.
Highlights
-
•
The activation of the Hippo pathway in response to vibratory mechanical forces is evaluated.
-
•
Cells subjected to vibratory settings of 50, 100, 150, and 200 Hz, categorized as low, medium, high, and very high.
-
•
An increased MST1 and LATS and decreased YAP and TAZ mRNA and protein levels were observed.
-
•
Vimentin mRNA increased, actin mRNA peaked at 100 Hz force application before decreasing.
-
•
Activation of the entire cytoprotective activity that protects periodontal ligament cells from traumatic injuries is observed.
Orthodontic treatment typically takes 15-18 months or longer. To shorten this, researchers explored physical, chemical, and surgical methods, with mixed results. Mechanical vibration, such as pulsed ultrasound, speeds up bone healing and tooth movement. Nishimura et al showed that 60 Hz vibration increased osteoclastic activity in rats, boosting tooth movement. Companies, such as Propel and OrthoAccel, developed devices using low- to high-frequency vibrations (approximately 30-120 Hz) to accelerate movement, but they lack significant clinical impact and are costly. Trials, reviews, and meta-analyses show weak evidence supporting vibratory forces, and the molecular effects on periodontal cells remain unstudied ,,
The Hippo pathway, or the Salvador-Warts-Hippo pathway, is a conserved signaling pathway that regulates organ size by controlling cell proliferation, apoptosis, and tissue regeneration. The mammalian Hippo pathway consists of 3 core molecular components: first, the mammalian sterile 20-like protein kinases MST1/2 (equivalent to Drosophila Hippo) that interact with the adaptor protein SAV1 (Drosophila Salvador); second, the large tumor suppressor kinases LATS1/2 (Drosophila Warts) and the binding cofactors MOB1A/B (Drosophila Mats); and third, the key downstream effectors and homologous transcriptional coactivators yes-associated protein YAP (Drosophila Yorkie) and transcriptional coactivator with a PDZ-binding motif TAZ (also known as WW domain-containing transcription regulator protein 1, WWTR1). Responding to signals from cell-cell contact, extracellular signaling, mechanotransduction, cytoskeleton remodeling, and cell polarity complexes, MST1/2 associates with SAV1 to phosphorylate and activate LATS1/2, complexed with MOB1A/B, initiating a kinase cascade. , Consequently, YAP and TAZ are phosphorylated and inhibited, leading to their exclusion from the nucleus through interactions with 14-3-3 proteins or proteasome-mediated degradation in the cytoplasm, which inhibits their transcriptional activity. Conversely, YAP/TAZ translocates to the nucleus when the Hippo signaling pathway is deactivated. It interacts with transcriptional enhanced associate domain (TEAD) or other transcription factors, regulating downstream signaling molecules associated with cell proliferation, apoptosis, differentiation, and maturation. ,,, Therefore, the ultimate consequence of Hippo pathway activation is the inhibition of YAP- and TAZ-mediated regulation of target gene expression, including cyclins, connective tissue growth factor, cysteine-rich protein 61, AXL, and survivin, among others ( Fig 1 ).
Within the canonical Hippo pathway ( magenta ), MST1/2 interacts with SAV1, phosphorylating LATS1/2. This leads to LATS1/2 activation, which in turn phosphorylates YAP/TAZ on 5 YAP and 4 TAZ conserved serine residues. These inhibitory phosphorylations signal the retention of YAP and TAZ in the cytoplasm, leading to binding to 14-3-3 protein or degradation. The activation of MST1/2 and LATS1/2 marks the Hippo pathway’s on-state, in which YAP/TAZ is inactive. In addition, Hippo-independent regulation of YAP/TAZ occurs through LATS1/2, the MAP4K kinase family, and STK25. In certain cases, nuclear dbf2-related1/2 kinases (NDR1/2) and substrates of MAP4K, MST1/2, and STK24 (MST3) directly phosphorylate and inhibit YAP. This additional network of kinases ( blue ) provides extra means for signal input, cellular adaptability, and robustness. Unphosphorylated YAP/TAZ enter the nucleus, in which they primarily interact with TEAD1-4 to regulate gene transcription. The activity of Hippo pathway core kinases is regulated by various stimuli, including cell-cell contact, extracellular signals, cell polarity, metabolic state, and mechanotransduction. SRC-activating YAP phosphorylation and SRC-inhibitory LATS phosphorylation also facilitate YAP nuclear localization and gene transcription induction. Further regulation of YAP/TAZ is achieved through Nemo-like kinase (NLK), 5′ adenosine mono phosphate (AMP)-activated protein kinase, cyclin-dependent kinase, and other kinases. The combined signals result in the activation or inhibition of co-transcriptional activators YAP and TAZ, allowing for specific and timely gene transcription regulation. (Reprinted with permission from Rausch V, Hansen CG. The Hippo pathway, YAP/TAZ, and the plasma membrane. Trends in cell biology. 2020 Jan 1;30(1):32-48).
Published research highlights that the actin cytoskeleton and cellular tension are key mediators that integrate and transmit upstream signals to the core Hippo signaling cascade. Actin forms a supportive network beneath the plasma membrane, influencing cell shape and movement. Its architecture and dynamics are crucial for regulating YAP/TAZ activity. , Emerging studies also show a complex role for vimentin, the intermediate filament protein, in fibroblast stress responses, acting as a force regulator that can reinforce or resist forces depending on substrate stiffness. A 2024 study by Alisafaei et al detailed the interactions among vimentin, actomyosin, and microtubules, which affect cell traction forces depending on matrix stiffness. In addition, in squamous cell carcinoma, decreased E-cadherin and increased vimentin, laminin 5, Slug, PRMT1, and PRMT5 were linked to elevated YAP1 levels.
Cell proliferation, differentiation, and apoptosis are essential processes. Cellular response to mechanical stimulation is complex, affecting cell mechanics and fate. Orthodontic literature suggests mechanical vibration, at low (20-120 Hz) or high (above 130 Hz) frequencies, to accelerate tooth movement, but efficacy remains controversial. Jian et al found that low-intensity pulsed ultrasound reduced periodontal ligament cell apoptosis by increasing YAP expression and nuclear translocation. Conversely, lowering YAP increased apoptosis and autophagy in lipopolysaccharide-treated cells. This study examines whether vibratory forces activate the actin-vimentin complex and the Hippo pathway in periodontal ligament fibroblasts, and whether different vibration forces alter the expression of YAP, TAZ, MST1, and LATS, exploring potential dose-dependent responses and the interrelationships among these molecules and their influence on the cellular response to mechanical vibratory forces.
Material and methods
The research was conducted at the Department of Orthodontics, Sri Sankara Dental College in Trivandrum, Kerala, India, with laboratory work carried out at the Center for Research on Molecular Biology and Applied Science in the same city. Patients who donated teeth were informed in advance, and their consent was obtained. Ethical approval was secured from the institutional ethical committee of Sri Sankara Dental College, with reference number B1/IEC/2022/007.
Human periodontal cells were isolated from the teeth of 3 female patients aged 15-17 years who had their teeth extracted for orthodontic purposes, following the protocol of Pagella et al. The selection of culturing periodontal ligament fibroblasts was mainly based on the fact that these fibroblasts are the predominant cell type, display greater heterogeneity, have a strong proliferative capacity, and are generally easier to culture than osteoblasts. Briefly, the tooth was first washed in sterile Hank Balanced Salt Solution. The periodontium was scraped using a surgical blade and transferred into individual (not pooled) tubes. The cell line was cultured in a 25 cm 2 tissue culture flask with Dulbecco Modified Eagle Medium (DMEM) supplemented with 10% fetal bovine serum, L-glutamine, sodium bicarbonate (Merck, Darmstadt, Germany), and an antibiotic solution containing Penicillin (100 U/mL), Streptomycin (100 μg/mL), and Amphotericin B (2.5 μg/mL). A confluent monolayer of cells grown for 2 days was trypsinized, and the cells were resuspended in 10% growth medium. A volume of 100 μL cell suspension (containing 5 × 10 3 cells/well) was seeded into a 96-well tissue culture plate and incubated at 37 ° C in a humidified 5% CO 2 incubator (Eppendorf SE, Hamburg, Germany). All experiments were performed using cells obtained at the second passage.
Cells were cultured in 5 flasks and subjected to vibratory forces at 50, 100, 150, and 200 Hz for 20 minutes, followed by incubation for 24 hours. This procedure was repeated after 24 and 48 hours. A custom vibratory device, developed and calibrated by our engineering department, provided these settings, based on previous research on vibration for tooth movement within the 100-150 Hz range. The device’s small size allowed placement inside the incubator, ensuring cell viability was unaffected by factors other than vibration. After 24 hours, we examined the entire plate using an inverted phase contrast microscope (Olympus CKX41 with Optika Pro5 CCD camera; Olympus Corporation, Tokyo, Japan) and captured images for the record ( Fig 2 , A – E ). Cell viability was assessed by microscopy and the MTT assay (Sigma; M-5655, Sigma-Aldrich, Mass) before RNA extraction. Changes, such as cell rounding, shrinking, granulation, or vacuolization, indicated nonviability. The percentage of viable cells under different vibratory forces, determined by the MTT assay, is shown in Figure 2 , F .
Inverted microscopic images of cultured periodontal ligament fibroblast cells after being subjected to various magnitudes of vibratory forces. Please note the amount of decrease in cell viability and change in morphology as force increases the following: A , control; B , 50 Hz force application; C , 100 Hz force application; D , 150 Hz force application; and E , 200 Hz force application. F, Percentage viability assessed through MTT assay after cells are subjected to varied magnitudes of vibratory forces.
Total RNA was isolated using the total RNA isolation kit (Invitrogen Bioservices; Waltham, Mass) in accordance with the manufacturer’s instructions from cells after 24 hours of incubation after exposure to various magnitudes of vibratory force. Total RNA was extracted using TRIzol (Invitrogen, Waltham, Mass), and its purity and concentration were determined. Template complementary DNA was synthesized using the cDNA preparation kit (G BIOSCIENCES; Saint Louis, Mo; Product code- 786-5019s,786-5020). Real-time–qualitative polymerase chain reaction (RT-qPCR) analysis was carried out using SYBR Green Master Mix (G BIOSCIENCES; Product code-786-5062) on a LightCycler 96 (Roche, Sigma-Aldrich). All reactions were performed in triplicate, and data were analyzed using the ΔΔCt method (Light Cycler 96 SW 1.1; Roche, Sigma-Aldrich). The primer sequences used are summarized in Table I and Table II . Agarose gel electrophoresis is a technique used to separate and visualize DNA fragments based on charge and size. When an electric field is applied across an electrolyte solution (buffer), DNA fragments move through the agarose gel matrix. Agar dissolves when boiled in water with a buffer and solidifies into a gel upon cooling. To prepare the gel, 1.5% agarose was dissolved in 1X TE buffer and heated at 90 ° C in a water bath. After cooling to 45 ° C, 6 μL of 10 mg/mL ethidium bromide was added. The mixture was poured into a gel casting apparatus with a gel comb. Once set, the comb was removed. The electrophoresis buffer was then poured into the gel tank, and the platform with the gel was immersed in it. Samples were loaded onto the gel, which was run at 50 V for 30 minutes. The visualization of vimentin and actin expression was achieved using a gel documentation system (ChemiDoc Imaging system; Biorad, Hercules, Calif).
Table I
Primer sequences for analyzing Hippo pathway-associated molecules
| Oligo name | Forward | Reverse | ||
|---|---|---|---|---|
| Sequence (5’->3’) | Tm | Sequence (5’->3’) | Tm | |
| H-GAPDH | ACTCAGAAGACTGTGGATGG | 57.3 | GTCATCATACTTGGCAGGTT | 55.3 |
| YAP | TTGGGAGATGGCAAAGACAT | 55.3 | CTGTGACGTTCATCTGGGAC | 59.3 |
| TAZ | GGCTGGGAGATGACCTTCA | 58.8 | AGGCACTGGTGTGGAACTGAC | 61.8 |
| LATS | CACTGGCTTCAGATGGACACAC | 62.1 | GGCTTCAGTCTGTCTCCACATC | 62.1 |
| MST1 | TGGTGCTACACGATGGACCCAA | 62.1 | GCCACACTTCTCAAACTGCACC | 62.1 |
GADPH, glyceraldehyde-3-phosphate dehydrogenase; TM , melting temperature.
Table II
Primer sequences for analyzing the actin-vimentin complex
| Oligo name | Forward | Reverse | ||
|---|---|---|---|---|
| Sequence (5’->3’) | Tm | Sequence (5’->3’) | Tm | |
| Vimentin | AGGCAAAGCAGGAGTCCACTGA | 62.1 | ATCTGGCGTTCCAGGGACTCAT | 62.1 |
| B actin | TCACCCACACTGTGCCCATCTACGA | 66.3 | CAGCGGAACCGCTCATTGCCAATGG | 67.9 |
| GAPDH | AATGCATCCTGCACCACCAACTGC | 64.4 | GGAGGCCATGTAGGCCATGAGGTC | 67.8 |
GADPH, glyceraldehyde-3-phosphate dehydrogenase; TM , melting temperature.
The cell culture dish was placed on ice, and the cells were washed with tris-buffered saline. Next, ice-cold radio-immunoprecipitation assay buffer was added (1 mL per 100 mM dish). The adherent cells in the dish were scraped using a cold plastic cell scraper and gently transferred into a precooled microcentrifuge tube containing gel suspension. Constant agitation was maintained for 30 minutes at 4 ° C. The mixture was sonicated 3 times for 10-15 seconds to reduce viscosity and ensure complete cell lysis and shearing of DNA. Afterward, it was centrifuged at 16000 × g force for 20 minutes in a precooled centrifuge at 4 ° C. The centrifuge tube was carefully removed and placed on ice. The supernatant was transferred to a new tube, and a small portion (10-20 μL) of lysate was taken for protein analysis. Protein concentration for each lysate was measured, and equal amounts (20 μg) of protein were loaded into the wells of a BOLT Bis-Tris 4-12% SDS-PAGE gel with molecular weight markers. The gel was initially run for 5 minutes at 50 V, then the voltage was increased to 100-150 V to complete the run in approximately 1 hour.
Proteins were immunoblotted using an iBlot 2 dry system (BOLT BISTRIS PLUS 4-12%; SKU No: NW04120BOX) following the manufacturer’s instructions (Invitrogen Bioservices). The procedure involved running the system at 25 V for 15 minutes, then preparing the nitrocellulose membrane for development. The membrane was briefly rinsed with water and stained with Ponceau to check transfer quality. It was then blocked in 5% bovine serum albumin in tris-buffered saline with Tween at room temperature for 1 hour. Incubation with primary antibodies (YAP, TAZ, MST1, and LATS) targeting the proteins of interest was carried out overnight. Next, the blot was rinsed 3-5 times for 5 minutes each in tris-buffered saline with Tween, then incubated in horseradish peroxidase–conjugated secondary antibody solution (Abcam Inc; Cambridge, Mass) for 1 hour at room temperature. Afterward, the membrane was removed, wrapped in plastic, and exposed to X-ray film for 1 minute. The film was then transferred to a fixer for 8 minutes with continuous agitation, washed in running water for 5 minutes, dried, and documented using a gel imaging system (Gel imager, Invitrogen). All analyses were performed in triplicate, and bands were captured with a standard gel documentation system (E gel imager, Life Technologies, part of Thermo Fisher Scientific, Carlsbad, Calif).